Incidental Mutation 'R1804:AF529169'
ID203394
Institutional Source Beutler Lab
Gene Symbol AF529169
Ensembl Gene ENSMUSG00000039313
Gene NamecDNA sequence AF529169
SynonymsDD1
MMRRC Submission 039834-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1804 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location89587216-89623125 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89603099 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 82 (M82L)
Ref Sequence ENSEMBL: ENSMUSP00000140942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044491] [ENSMUST00000191465]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044491
AA Change: M82L

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000046111
Gene: ENSMUSG00000039313
AA Change: M82L

DomainStartEndE-ValueType
low complexity region 508 522 N/A INTRINSIC
Pfam:UPF0258 760 915 8.7e-73 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000191465
AA Change: M82L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140942
Gene: ENSMUSG00000039313
AA Change: M82L

DomainStartEndE-ValueType
low complexity region 508 522 N/A INTRINSIC
Pfam:UPF0258 759 854 6.1e-38 PFAM
Meta Mutation Damage Score 0.0698 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.5%
  • 20x: 89.8%
Validation Efficiency 96% (77/80)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,203 Y220H probably benign Het
2610507B11Rik A G 11: 78,273,469 H1165R probably damaging Het
4930579C12Rik T C 9: 89,152,060 noncoding transcript Het
Abcc8 T C 7: 46,120,479 S871G probably benign Het
Acly T C 11: 100,515,905 Y288C probably damaging Het
Adgrb1 T A 15: 74,529,540 D128E probably damaging Het
Alms1 C T 6: 85,621,275 Q1497* probably null Het
Cacna1c G A 6: 118,687,046 T688M probably damaging Het
Ccdc7a A T 8: 128,988,766 L279* probably null Het
Cep135 A G 5: 76,636,932 E958G probably benign Het
Clec4n G T 6: 123,230,022 V2L possibly damaging Het
Col28a1 C T 6: 8,164,612 probably null Het
Dcaf5 A G 12: 80,339,829 S508P probably benign Het
Dlgap2 C A 8: 14,727,809 N351K possibly damaging Het
Dnah8 T A 17: 30,708,407 Y1346N probably benign Het
Dqx1 T C 6: 83,060,322 V322A probably damaging Het
Ebf3 A C 7: 137,200,521 L412V possibly damaging Het
Epha5 T C 5: 84,331,815 N110S probably benign Het
Fcgbp T C 7: 28,086,139 C334R probably benign Het
Glp1r T A 17: 30,930,713 probably null Het
Gm4952 G T 19: 12,618,420 R58L probably damaging Het
Gm7579 G A 7: 142,211,938 C27Y unknown Het
Golm1 T A 13: 59,642,389 probably null Het
Gucy2g T A 19: 55,210,309 I801F probably benign Het
H2-D1 T C 17: 35,263,552 Y83H probably damaging Het
Homez A T 14: 54,857,141 I19N probably damaging Het
Hoxa5 T C 6: 52,202,648 K249R probably damaging Het
Hsd17b4 A T 18: 50,177,984 N550Y probably damaging Het
Ipo4 A T 14: 55,629,456 N668K probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klb A G 5: 65,379,853 D842G probably damaging Het
Mmp21 G T 7: 133,678,882 P120T probably benign Het
Mroh7 T A 4: 106,694,392 I918F possibly damaging Het
Muc5b A G 7: 141,863,780 T3488A possibly damaging Het
Npc1 C T 18: 12,223,088 C42Y probably damaging Het
Ogdh A G 11: 6,338,565 Y214C probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr1277 T C 2: 111,269,930 M146V probably benign Het
Olfr450 G A 6: 42,818,221 C250Y possibly damaging Het
Olfr726 A T 14: 50,083,902 W260R probably damaging Het
Olfr930 A G 9: 38,930,650 T160A possibly damaging Het
Phtf1 A G 3: 103,987,567 probably benign Het
Plb1 A G 5: 32,353,697 N1302S possibly damaging Het
Prex2 A G 1: 11,132,342 K492E probably damaging Het
Prkaa1 A G 15: 5,178,778 D509G probably benign Het
Rims2 C T 15: 39,437,043 Q57* probably null Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rraga A G 4: 86,576,444 I176V probably damaging Het
Rrm2 T C 12: 24,708,612 I51T probably benign Het
Serpina3a T A 12: 104,118,416 probably benign Het
Skint7 T C 4: 111,982,012 W168R probably damaging Het
Slc27a4 A G 2: 29,811,267 M357V probably benign Het
Slc4a3 A G 1: 75,551,717 H452R probably damaging Het
Smc1b A T 15: 85,127,790 I127K possibly damaging Het
Snap91 T A 9: 86,783,417 M383L probably benign Het
Taf6l A T 19: 8,773,634 L52Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tas2r124 A G 6: 132,755,525 I266V probably benign Het
Tesk2 T C 4: 116,800,621 probably benign Het
Tmem131l T G 3: 83,910,479 Q1237P possibly damaging Het
Tmem67 A G 4: 12,045,789 probably null Het
Tnfaip8 T A 18: 50,090,661 C179S probably damaging Het
Ush2a G A 1: 188,633,729 probably null Het
Vps13b A T 15: 35,917,137 E3709V probably damaging Het
Wdr7 A T 18: 63,865,440 S1153C probably damaging Het
Zc2hc1b A C 10: 13,171,268 probably benign Het
Zfp438 A G 18: 5,213,689 I423T probably damaging Het
Zfp592 C A 7: 81,023,695 P136T probably damaging Het
Zfp783 T A 6: 47,945,885 noncoding transcript Het
Zfp804b A T 5: 6,771,756 S400T possibly damaging Het
Other mutations in AF529169
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:AF529169 APN 9 89601800 missense probably benign 0.02
IGL00163:AF529169 APN 9 89591097 unclassified probably benign
IGL00336:AF529169 APN 9 89603143 missense probably damaging 1.00
IGL01608:AF529169 APN 9 89596498 missense probably benign 0.15
IGL01818:AF529169 APN 9 89601313 missense probably damaging 0.99
IGL02012:AF529169 APN 9 89601438 missense probably benign 0.01
IGL02259:AF529169 APN 9 89602359 missense possibly damaging 0.93
IGL02894:AF529169 APN 9 89603102 missense probably damaging 0.99
IGL03008:AF529169 APN 9 89596678 missense probably damaging 1.00
IGL02988:AF529169 UTSW 9 89602739 missense probably benign 0.02
R0410:AF529169 UTSW 9 89602203 missense probably damaging 0.97
R0825:AF529169 UTSW 9 89603279 nonsense probably null
R0883:AF529169 UTSW 9 89602417 missense probably benign 0.05
R0989:AF529169 UTSW 9 89602035 missense probably damaging 0.99
R1376:AF529169 UTSW 9 89591246 missense probably damaging 1.00
R1376:AF529169 UTSW 9 89591246 missense probably damaging 1.00
R1632:AF529169 UTSW 9 89602360 missense probably damaging 0.96
R1974:AF529169 UTSW 9 89601203 missense probably damaging 1.00
R2151:AF529169 UTSW 9 89602168 missense possibly damaging 0.53
R2882:AF529169 UTSW 9 89602802 missense possibly damaging 0.86
R2909:AF529169 UTSW 9 89591278 missense probably damaging 1.00
R3961:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R3962:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R3963:AF529169 UTSW 9 89601910 missense probably damaging 1.00
R4676:AF529169 UTSW 9 89601553 missense probably damaging 1.00
R4778:AF529169 UTSW 9 89603102 missense probably damaging 1.00
R4931:AF529169 UTSW 9 89601652 missense probably benign 0.05
R5300:AF529169 UTSW 9 89603199 missense probably damaging 1.00
R5702:AF529169 UTSW 9 89591155 missense probably benign 0.22
R5759:AF529169 UTSW 9 89601072 missense probably benign 0.01
R6187:AF529169 UTSW 9 89591167 missense probably damaging 1.00
R7320:AF529169 UTSW 9 89601626 missense probably benign
R7542:AF529169 UTSW 9 89601911 missense probably damaging 1.00
R7552:AF529169 UTSW 9 89601835 missense probably benign 0.00
U24488:AF529169 UTSW 9 89603047 missense probably damaging 1.00
Z1177:AF529169 UTSW 9 89603162 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTTGGATGACTGCCTG -3'
(R):5'- TTTCCTATCAAGACCTGTGCAAG -3'

Sequencing Primer
(F):5'- TGAAGGGTCTCTCACTCAGC -3'
(R):5'- AGACCTGTGCAAGTCACTCTGTG -3'
Posted On2014-06-23