Incidental Mutation 'R1804:Vps13b'
ID203410
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Namevacuolar protein sorting 13B
Synonyms2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik
MMRRC Submission 039834-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1804 (G1)
Quality Score114
Status Validated
Chromosome15
Chromosomal Location35371160-35931229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35917137 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 3709 (E3709V)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
Predicted Effect probably damaging
Transcript: ENSMUST00000048646
AA Change: E3709V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: E3709V

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Meta Mutation Damage Score 0.2404 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.5%
  • 20x: 89.8%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,203 Y220H probably benign Het
2610507B11Rik A G 11: 78,273,469 H1165R probably damaging Het
4930579C12Rik T C 9: 89,152,060 noncoding transcript Het
Abcc8 T C 7: 46,120,479 S871G probably benign Het
Acly T C 11: 100,515,905 Y288C probably damaging Het
Adgrb1 T A 15: 74,529,540 D128E probably damaging Het
AF529169 T A 9: 89,603,099 M82L possibly damaging Het
Alms1 C T 6: 85,621,275 Q1497* probably null Het
Cacna1c G A 6: 118,687,046 T688M probably damaging Het
Ccdc7a A T 8: 128,988,766 L279* probably null Het
Cep135 A G 5: 76,636,932 E958G probably benign Het
Clec4n G T 6: 123,230,022 V2L possibly damaging Het
Col28a1 C T 6: 8,164,612 probably null Het
Dcaf5 A G 12: 80,339,829 S508P probably benign Het
Dlgap2 C A 8: 14,727,809 N351K possibly damaging Het
Dnah8 T A 17: 30,708,407 Y1346N probably benign Het
Dqx1 T C 6: 83,060,322 V322A probably damaging Het
Ebf3 A C 7: 137,200,521 L412V possibly damaging Het
Epha5 T C 5: 84,331,815 N110S probably benign Het
Fcgbp T C 7: 28,086,139 C334R probably benign Het
Glp1r T A 17: 30,930,713 probably null Het
Gm4952 G T 19: 12,618,420 R58L probably damaging Het
Gm7579 G A 7: 142,211,938 C27Y unknown Het
Golm1 T A 13: 59,642,389 probably null Het
Gucy2g T A 19: 55,210,309 I801F probably benign Het
H2-D1 T C 17: 35,263,552 Y83H probably damaging Het
Homez A T 14: 54,857,141 I19N probably damaging Het
Hoxa5 T C 6: 52,202,648 K249R probably damaging Het
Hsd17b4 A T 18: 50,177,984 N550Y probably damaging Het
Ipo4 A T 14: 55,629,456 N668K probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klb A G 5: 65,379,853 D842G probably damaging Het
Mmp21 G T 7: 133,678,882 P120T probably benign Het
Mroh7 T A 4: 106,694,392 I918F possibly damaging Het
Muc5b A G 7: 141,863,780 T3488A possibly damaging Het
Npc1 C T 18: 12,223,088 C42Y probably damaging Het
Ogdh A G 11: 6,338,565 Y214C probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr1277 T C 2: 111,269,930 M146V probably benign Het
Olfr450 G A 6: 42,818,221 C250Y possibly damaging Het
Olfr726 A T 14: 50,083,902 W260R probably damaging Het
Olfr930 A G 9: 38,930,650 T160A possibly damaging Het
Phtf1 A G 3: 103,987,567 probably benign Het
Plb1 A G 5: 32,353,697 N1302S possibly damaging Het
Prex2 A G 1: 11,132,342 K492E probably damaging Het
Prkaa1 A G 15: 5,178,778 D509G probably benign Het
Rims2 C T 15: 39,437,043 Q57* probably null Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rraga A G 4: 86,576,444 I176V probably damaging Het
Rrm2 T C 12: 24,708,612 I51T probably benign Het
Serpina3a T A 12: 104,118,416 probably benign Het
Skint7 T C 4: 111,982,012 W168R probably damaging Het
Slc27a4 A G 2: 29,811,267 M357V probably benign Het
Slc4a3 A G 1: 75,551,717 H452R probably damaging Het
Smc1b A T 15: 85,127,790 I127K possibly damaging Het
Snap91 T A 9: 86,783,417 M383L probably benign Het
Taf6l A T 19: 8,773,634 L52Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tas2r124 A G 6: 132,755,525 I266V probably benign Het
Tesk2 T C 4: 116,800,621 probably benign Het
Tmem131l T G 3: 83,910,479 Q1237P possibly damaging Het
Tmem67 A G 4: 12,045,789 probably null Het
Tnfaip8 T A 18: 50,090,661 C179S probably damaging Het
Ush2a G A 1: 188,633,729 probably null Het
Wdr7 A T 18: 63,865,440 S1153C probably damaging Het
Zc2hc1b A C 10: 13,171,268 probably benign Het
Zfp438 A G 18: 5,213,689 I423T probably damaging Het
Zfp592 C A 7: 81,023,695 P136T probably damaging Het
Zfp783 T A 6: 47,945,885 noncoding transcript Het
Zfp804b A T 5: 6,771,756 S400T possibly damaging Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35926226 missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35793884 missense probably damaging 1.00
IGL00516:Vps13b APN 15 35640557 missense probably damaging 1.00
IGL00640:Vps13b APN 15 35417577 missense probably benign
IGL00753:Vps13b APN 15 35372031 missense probably damaging 0.99
IGL00784:Vps13b APN 15 35846900 missense probably damaging 1.00
IGL01138:Vps13b APN 15 35446770 splice site probably benign
IGL01349:Vps13b APN 15 35793945 missense probably benign 0.00
IGL01403:Vps13b APN 15 35709479 missense probably benign 0.00
IGL01535:Vps13b APN 15 35454957 missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35877489 splice site probably benign
IGL01642:Vps13b APN 15 35792072 missense probably benign 0.43
IGL01658:Vps13b APN 15 35671333 missense probably damaging 0.99
IGL01759:Vps13b APN 15 35878789 missense probably damaging 1.00
IGL01763:Vps13b APN 15 35709799 missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35639847 splice site probably benign
IGL01982:Vps13b APN 15 35438904 nonsense probably null
IGL01997:Vps13b APN 15 35709224 missense probably damaging 1.00
IGL02041:Vps13b APN 15 35423245 missense probably damaging 0.98
IGL02073:Vps13b APN 15 35875586 missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35910613 missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35572081 missense probably benign 0.09
IGL02146:Vps13b APN 15 35646333 missense probably benign 0.36
IGL02197:Vps13b APN 15 35930056 missense probably benign 0.02
IGL02311:Vps13b APN 15 35709514 missense probably benign 0.08
IGL02466:Vps13b APN 15 35770741 missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35917162 missense probably damaging 1.00
IGL02550:Vps13b APN 15 35572096 missense probably benign
IGL02553:Vps13b APN 15 35646301 missense probably benign 0.00
IGL02674:Vps13b APN 15 35639958 missense probably benign 0.41
IGL02690:Vps13b APN 15 35917142 missense probably damaging 1.00
IGL02731:Vps13b APN 15 35917128 missense probably benign 0.00
IGL02739:Vps13b APN 15 35879900 missense probably damaging 1.00
IGL02868:Vps13b APN 15 35884519 missense probably benign 0.03
IGL03081:Vps13b APN 15 35875820 missense probably damaging 0.97
IGL03178:Vps13b APN 15 35869300 missense probably damaging 1.00
IGL03343:Vps13b APN 15 35917170 missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35639866 missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35910340 missense probably benign
omlette UTSW 15 35671400 missense probably benign 0.13
swiss UTSW 15 35709673 missense possibly damaging 0.80
FR4449:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35846957 missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35846957 missense probably damaging 1.00
PIT4531001:Vps13b UTSW 15 35878825 missense probably damaging 1.00
PIT4581001:Vps13b UTSW 15 35534263 missense probably damaging 1.00
PIT4618001:Vps13b UTSW 15 35709240 missense probably damaging 1.00
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0116:Vps13b UTSW 15 35423155 missense probably damaging 0.99
R0123:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0124:Vps13b UTSW 15 35576528 critical splice donor site probably null
R0134:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0137:Vps13b UTSW 15 35926219 missense probably benign 0.06
R0195:Vps13b UTSW 15 35471899 missense probably benign 0.00
R0225:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0320:Vps13b UTSW 15 35674828 missense probably damaging 0.98
R0333:Vps13b UTSW 15 35879803 missense probably damaging 1.00
R0336:Vps13b UTSW 15 35455133 nonsense probably null
R0463:Vps13b UTSW 15 35597409 missense probably damaging 0.98
R0466:Vps13b UTSW 15 35445602 nonsense probably null
R0472:Vps13b UTSW 15 35417633 critical splice donor site probably null
R0523:Vps13b UTSW 15 35472050 missense probably benign 0.20
R0602:Vps13b UTSW 15 35422368 missense probably damaging 1.00
R0612:Vps13b UTSW 15 35623657 missense probably benign 0.12
R0627:Vps13b UTSW 15 35371999 nonsense probably null
R0679:Vps13b UTSW 15 35709703 missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35794361 missense probably benign 0.22
R1053:Vps13b UTSW 15 35652363 missense probably damaging 1.00
R1355:Vps13b UTSW 15 35422454 missense probably damaging 1.00
R1386:Vps13b UTSW 15 35923312 missense probably damaging 0.99
R1403:Vps13b UTSW 15 35709122 splice site probably benign
R1453:Vps13b UTSW 15 35422444 missense probably damaging 0.97
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1511:Vps13b UTSW 15 35839975 missense probably damaging 0.99
R1511:Vps13b UTSW 15 35841573 missense probably benign 0.00
R1513:Vps13b UTSW 15 35438730 nonsense probably null
R1536:Vps13b UTSW 15 35875566 missense probably damaging 0.98
R1537:Vps13b UTSW 15 35792181 missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35534319 missense probably damaging 1.00
R1601:Vps13b UTSW 15 35642436 missense probably benign 0.11
R1653:Vps13b UTSW 15 35607272 nonsense probably null
R1695:Vps13b UTSW 15 35576521 missense probably benign 0.05
R1760:Vps13b UTSW 15 35884619 missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1786:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1803:Vps13b UTSW 15 35430205 nonsense probably null
R1808:Vps13b UTSW 15 35792059 missense probably benign 0.00
R1817:Vps13b UTSW 15 35910642 missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35877577 missense probably benign 0.00
R1836:Vps13b UTSW 15 35910232 missense probably damaging 0.99
R1850:Vps13b UTSW 15 35674959 splice site probably benign
R1884:Vps13b UTSW 15 35430291 splice site probably benign
R1938:Vps13b UTSW 15 35709507 missense probably damaging 1.00
R1955:Vps13b UTSW 15 35925408 critical splice donor site probably null
R1956:Vps13b UTSW 15 35869407 missense probably damaging 1.00
R1958:Vps13b UTSW 15 35878689 missense probably damaging 0.99
R2013:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2014:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2015:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2038:Vps13b UTSW 15 35884741 missense probably damaging 1.00
R2058:Vps13b UTSW 15 35841447 missense probably damaging 1.00
R2082:Vps13b UTSW 15 35910746 missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35597493 missense probably damaging 0.99
R2124:Vps13b UTSW 15 35646080 missense probably benign 0.08
R2130:Vps13b UTSW 15 35671400 missense probably benign 0.13
R2168:Vps13b UTSW 15 35792188 missense probably damaging 1.00
R2168:Vps13b UTSW 15 35792189 missense probably damaging 1.00
R2171:Vps13b UTSW 15 35887197 missense probably benign 0.44
R2221:Vps13b UTSW 15 35884597 missense probably benign
R2263:Vps13b UTSW 15 35646181 missense probably benign 0.02
R2289:Vps13b UTSW 15 35572105 missense probably damaging 1.00
R2316:Vps13b UTSW 15 35674899 nonsense probably null
R2351:Vps13b UTSW 15 35869311 missense probably damaging 1.00
R2512:Vps13b UTSW 15 35884555 missense probably benign 0.35
R3054:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3055:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3196:Vps13b UTSW 15 35869395 missense probably damaging 1.00
R3236:Vps13b UTSW 15 35910304 missense probably benign 0.40
R3404:Vps13b UTSW 15 35926054 missense probably damaging 1.00
R3722:Vps13b UTSW 15 35671382 missense probably damaging 0.99
R4077:Vps13b UTSW 15 35455128 missense probably damaging 0.99
R4153:Vps13b UTSW 15 35792027 splice site probably null
R4224:Vps13b UTSW 15 35876419 missense probably damaging 0.99
R4408:Vps13b UTSW 15 35709294 missense probably damaging 0.98
R4431:Vps13b UTSW 15 35770753 missense probably damaging 1.00
R4449:Vps13b UTSW 15 35876793 missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35709673 missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35646132 missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35770689 missense probably benign
R4666:Vps13b UTSW 15 35640544 missense probably benign 0.13
R4684:Vps13b UTSW 15 35646178 missense probably damaging 0.98
R4684:Vps13b UTSW 15 35841341 missense probably benign
R4684:Vps13b UTSW 15 35879821 missense probably benign
R4721:Vps13b UTSW 15 35910718 nonsense probably null
R4771:Vps13b UTSW 15 35910800 missense probably damaging 1.00
R4830:Vps13b UTSW 15 35452224 missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35869372 missense probably damaging 1.00
R4835:Vps13b UTSW 15 35910293 missense probably benign
R4857:Vps13b UTSW 15 35456654 missense probably benign 0.01
R4891:Vps13b UTSW 15 35640515 splice site probably null
R5095:Vps13b UTSW 15 35923202 missense probably damaging 1.00
R5110:Vps13b UTSW 15 35770809 missense probably damaging 0.99
R5147:Vps13b UTSW 15 35456678 missense probably benign 0.32
R5153:Vps13b UTSW 15 35422453 missense probably damaging 0.99
R5257:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35876413 missense probably damaging 1.00
R5386:Vps13b UTSW 15 35640528 critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35886948 missense probably damaging 0.99
R5412:Vps13b UTSW 15 35533385 missense probably damaging 1.00
R5488:Vps13b UTSW 15 35770542 missense probably benign
R5489:Vps13b UTSW 15 35770542 missense probably benign
R5503:Vps13b UTSW 15 35452166 missense probably damaging 0.97
R5575:Vps13b UTSW 15 35929919 missense probably damaging 1.00
R5781:Vps13b UTSW 15 35794035 missense probably damaging 0.97
R5872:Vps13b UTSW 15 35869351 missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35917061 missense probably damaging 0.99
R5994:Vps13b UTSW 15 35875772 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6045:Vps13b UTSW 15 35671316 missense probably damaging 0.99
R6143:Vps13b UTSW 15 35668738 missense probably damaging 0.99
R6147:Vps13b UTSW 15 35930031 missense probably benign 0.16
R6218:Vps13b UTSW 15 35770464 missense probably benign 0.00
R6447:Vps13b UTSW 15 35572126 missense probably benign 0.02
R6555:Vps13b UTSW 15 35846847 missense probably damaging 1.00
R6578:Vps13b UTSW 15 35446101 missense probably damaging 0.99
R6640:Vps13b UTSW 15 35617696 missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35910305 missense probably benign 0.25
R6711:Vps13b UTSW 15 35887249 missense probably damaging 1.00
R6727:Vps13b UTSW 15 35770683 missense probably benign 0.19
R6737:Vps13b UTSW 15 35910611 missense probably damaging 1.00
R6844:Vps13b UTSW 15 35877590 missense probably benign 0.06
R6849:Vps13b UTSW 15 35905309 missense probably damaging 1.00
R6861:Vps13b UTSW 15 35576395 missense probably damaging 0.99
R6938:Vps13b UTSW 15 35423198 missense probably damaging 0.99
R6943:Vps13b UTSW 15 35448689 missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35448581 missense probably benign 0.02
R7092:Vps13b UTSW 15 35640634 missense probably damaging 1.00
R7232:Vps13b UTSW 15 35877557 missense probably damaging 1.00
R7307:Vps13b UTSW 15 35841545 missense probably benign
R7400:Vps13b UTSW 15 35378900 missense probably damaging 1.00
R7414:Vps13b UTSW 15 35910827 missense probably damaging 1.00
R7497:Vps13b UTSW 15 35876697 missense probably benign 0.38
R7500:Vps13b UTSW 15 35910524 missense possibly damaging 0.74
R7603:Vps13b UTSW 15 35576439 missense probably damaging 0.98
R7605:Vps13b UTSW 15 35770646 missense probably damaging 0.97
R7849:Vps13b UTSW 15 35423232 missense probably damaging 0.99
R8094:Vps13b UTSW 15 35668906 critical splice donor site probably null
R8097:Vps13b UTSW 15 35709346 missense probably benign 0.38
R8131:Vps13b UTSW 15 35372109 critical splice donor site probably null
R8139:Vps13b UTSW 15 35607272 nonsense probably null
R8174:Vps13b UTSW 15 35709310 nonsense probably null
R8225:Vps13b UTSW 15 35794382 missense probably damaging 0.99
R8239:Vps13b UTSW 15 35597404 missense probably damaging 1.00
R8244:Vps13b UTSW 15 35917203 missense probably damaging 1.00
R8303:Vps13b UTSW 15 35639917 missense probably damaging 1.00
R8311:Vps13b UTSW 15 35886954 missense probably benign 0.37
RF020:Vps13b UTSW 15 35925406 missense probably null 1.00
X0026:Vps13b UTSW 15 35910646 missense probably damaging 1.00
X0028:Vps13b UTSW 15 35709431 missense probably benign 0.00
Z1177:Vps13b UTSW 15 35668885 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTCTTAGCCACTCAGTGC -3'
(R):5'- GGGACTGTTCCTTCATAGCTC -3'

Sequencing Primer
(F):5'- TTAGCCACTCAGTGCTGCTGG -3'
(R):5'- TTATGAAAGGTCGCGAACTCC -3'
Posted On2014-06-23