Mutagenetix > Incidental Mutation

Incidental Mutation 'R1806:Aqr'

203436

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

039835-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1806 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114161652 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 81 (Y81C)

Ref Sequence

ENSEMBL: ENSMUSP00000047157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

AlphaFold

Q8CFQ3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043160
AA Change: Y81C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: Y81C

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102543
AA Change: Y81C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: Y81C

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131785

Meta Mutation Damage Score

0.8206

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.9%
20x: 91.2%

Validation Efficiency

96% (77/80)

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Adamts15	C	A	9: 30,904,815	C616F	probably damaging	Het
Adarb1	T	C	10: 77,322,265	N116S	probably damaging	Het
Add2	C	T	6: 86,118,657	S437L	probably damaging	Het
Adra1d	T	A	2: 131,546,149	R495S	probably benign	Het
Agk	C	T	6: 40,387,495	T309I	probably damaging	Het
Bak1	G	A	17: 27,021,268	Q142*	probably null	Het
Bckdha	A	G	7: 25,631,420	V307A	probably damaging	Het
Camk2n2	C	A	16: 20,620,198	G72V	probably benign	Het
Cd276	A	T	9: 58,527,562		probably benign	Het
Cd2ap	G	A	17: 42,838,758	Q122*	probably null	Het
Cdan1	T	A	2: 120,731,426		probably benign	Het
Cdh3	T	C	8: 106,536,915	S156P	probably benign	Het
Chil4	T	A	3: 106,210,643		probably benign	Het
Col11a1	C	T	3: 114,158,142	R1074C	probably damaging	Het
Fcrlb	T	C	1: 170,907,527	T344A	probably benign	Het
Fras1	T	A	5: 96,713,970		probably benign	Het
Fras1	G	T	5: 96,764,976	V3380F	possibly damaging	Het
Galnt9	A	G	5: 110,619,253	D530G	possibly damaging	Het
Gja10	A	T	4: 32,601,135	S416R	probably benign	Het
Gm10549	T	A	18: 33,470,788	V108E	unknown	Het
Gm8298	T	C	3: 59,877,150	L348P	probably damaging	Het
Hook3	A	T	8: 26,068,659	L59Q	probably damaging	Het
Hpf1	T	A	8: 60,900,120	D178E	probably benign	Het
Hsd17b7	T	C	1: 169,961,129	N173S	possibly damaging	Het
Hsph1	A	G	5: 149,629,989	F236L	probably damaging	Het
Kcnk12	G	T	17: 87,746,109	T375K	probably benign	Het
Kdelc2	T	C	9: 53,395,850	Y365H	probably damaging	Het
Klra3	A	T	6: 130,327,070	S220T	probably damaging	Het
Lhx1	A	T	11: 84,524,141	L12Q	probably damaging	Het
Lnx1	A	G	5: 74,606,049	L468P	probably damaging	Het
Ltbp3	T	A	19: 5,753,942	C827*	probably null	Het
Mical1	C	T	10: 41,478,214	A53V	probably damaging	Het
Mmp10	A	T	9: 7,506,501	H326L	probably benign	Het
Mpl	A	T	4: 118,443,532	M600K	possibly damaging	Het
Muc5b	T	A	7: 141,865,493	D4004E	possibly damaging	Het
Myo5b	A	T	18: 74,577,609	H98L	possibly damaging	Het
Nbeal1	A	G	1: 60,284,092	T2110A	probably damaging	Het
Nedd4l	C	A	18: 65,212,791	R825S	probably damaging	Het
Ntn4	C	T	10: 93,707,353	R314W	probably damaging	Het
Olfr1277	A	T	2: 111,270,277	I30N	possibly damaging	Het
Olfr228	A	T	2: 86,483,139	I201N	probably damaging	Het
Olfr596	T	A	7: 103,310,225	L168Q	probably damaging	Het
Otog	A	T	7: 46,290,937		probably null	Het
Parp2	T	A	14: 50,819,379	L320H	probably damaging	Het
Pola2	C	T	19: 5,943,222		probably null	Het
Poln	A	T	5: 34,107,150		probably benign	Het
Pomt1	T	A	2: 32,241,668	V123E	probably damaging	Het
Prom2	T	C	2: 127,532,882	Y578C	probably damaging	Het
Prss23	T	C	7: 89,510,391	T157A	probably damaging	Het
Sdk1	T	A	5: 141,613,195	V205E	probably damaging	Het
Sdk1	A	G	5: 142,161,926	K1771R	probably benign	Het
Sidt1	A	T	16: 44,281,871	S309T	possibly damaging	Het
Sirpa	T	A	2: 129,615,512	F169I	probably damaging	Het
Slc8a1	T	C	17: 81,648,487	N374S	probably damaging	Het
Sp110	C	T	1: 85,596,110		probably null	Het
Stard9	A	G	2: 120,679,453		probably null	Het
Synpr	A	G	14: 13,563,082	N105S	probably damaging	Het
Tbc1d16	T	C	11: 119,156,101	Y440C	probably damaging	Het
Trabd	A	G	15: 89,085,621	I313V	possibly damaging	Het
Trappc10	T	C	10: 78,210,776	R430G	probably damaging	Het
Trim50	A	G	5: 135,358,889	E145G	probably benign	Het
Uba2	A	T	7: 34,163,199	F105I	probably damaging	Het
Uba3	A	G	6: 97,199,269	V92A	possibly damaging	Het
Uhmk1	T	C	1: 170,211,059	K153R	probably damaging	Het
Vmn2r3	T	A	3: 64,275,472	M269L	probably benign	Het
Vmn2r3	T	C	3: 64,287,389	K8R	possibly damaging	Het
Xpot	G	T	10: 121,607,638		probably benign	Het
Zfp128	A	G	7: 12,891,022	Y439C	probably benign	Het
Zfy1	T	A	Y: 725,620	H715L	possibly damaging	Het
Zmym1	A	C	4: 127,048,079	L839V	probably damaging	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	114136993	missense	probably damaging	0.98
R9487:Aqr	UTSW	2	114104047	missense	probably benign	0.04
R9527:Aqr	UTSW	2	114101556	missense	probably benign	0.02
R9664:Aqr	UTSW	2	114140915	nonsense	probably null
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- AAGAGGACACTGCTACCAGG -3'
(R):5'- TGAGCCACGGTTTCTACATC -3'

Sequencing Primer
(F):5'- GGAAAAGATCCCGCTACTCTGTATCG -3'
(R):5'- CTACATCTACGTGTCCGGTGG -3'

Posted On

2014-06-23