Incidental Mutation 'R1806:Mpl'
ID203446
Institutional Source Beutler Lab
Gene Symbol Mpl
Ensembl Gene ENSMUSG00000006389
Gene Namemyeloproliferative leukemia virus oncogene
SynonymsTPO-R, thrombopoietin receptor, c-mpl, hlb219, CD110, c-mpl-I, c-mpl-II
MMRRC Submission 039835-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1806 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118442415-118457513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118443532 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 600 (M600K)
Ref Sequence ENSEMBL: ENSMUSP00000006556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006556] [ENSMUST00000102671] [ENSMUST00000106375]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006556
AA Change: M600K

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000006556
Gene: ENSMUSG00000006389
AA Change: M600K

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 1.9e-31 PFAM
Pfam:IL6Ra-bind 27 118 1.8e-7 PFAM
FN3 126 257 7.7e-3 SMART
FN3 382 461 2.83e0 SMART
transmembrane domain 483 505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102671
AA Change: M592K

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099732
Gene: ENSMUSG00000006389
AA Change: M592K

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.4e-32 PFAM
Pfam:IL6Ra-bind 34 125 7.3e-9 PFAM
FN3 133 256 1.09e-2 SMART
FN3 381 460 2.83e0 SMART
transmembrane domain 482 504 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106375
AA Change: M533K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000101983
Gene: ENSMUSG00000006389
AA Change: M533K

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 18 121 9.4e-32 PFAM
Pfam:IL6Ra-bind 27 119 7.4e-8 PFAM
FN3 322 401 2.83e0 SMART
transmembrane domain 423 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121913
Predicted Effect probably benign
Transcript: ENSMUST00000168404
SMART Domains Protein: ENSMUSP00000130167
Gene: ENSMUSG00000006389

DomainStartEndE-ValueType
Pfam:EpoR_lig-bind 25 128 1.9e-31 PFAM
FN3 133 264 7.7e-3 SMART
FN3 389 468 2.83e0 SMART
transmembrane domain 490 512 N/A INTRINSIC
Meta Mutation Damage Score 0.0678 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In 1990 an oncogene, v-mpl, was identified from the murine myeloproliferative leukemia virus that was capable of immortalizing bone marrow hematopoietic cells from different lineages. In 1992 the human homologue, named, c-mpl, was cloned. Sequence data revealed that c-mpl encoded a protein that was homologous with members of the hematopoietic receptor superfamily. Presence of anti-sense oligodeoxynucleotides of c-mpl inhibited megakaryocyte colony formation. The ligand for c-mpl, thrombopoietin, was cloned in 1994. Thrombopoietin was shown to be the major regulator of megakaryocytopoiesis and platelet formation. The protein encoded by the c-mpl gene, CD110, is a 635 amino acid transmembrane domain, with two extracellular cytokine receptor domains and two intracellular cytokine receptor box motifs . TPO-R deficient mice were severely thrombocytopenic, emphasizing the important role of CD110 and thrombopoietin in megakaryocyte and platelet formation. Upon binding of thrombopoietin CD110 is dimerized and the JAK family of non-receptor tyrosine kinases, as well as the STAT family, the MAPK family, the adaptor protein Shc and the receptors themselves become tyrosine phosphorylated. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations at this locus are unable to produce normal amounts of megakaryocytes and platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Adamts15 C A 9: 30,904,815 C616F probably damaging Het
Adarb1 T C 10: 77,322,265 N116S probably damaging Het
Add2 C T 6: 86,118,657 S437L probably damaging Het
Adra1d T A 2: 131,546,149 R495S probably benign Het
Agk C T 6: 40,387,495 T309I probably damaging Het
Aqr T C 2: 114,161,652 Y81C probably damaging Het
Bak1 G A 17: 27,021,268 Q142* probably null Het
Bckdha A G 7: 25,631,420 V307A probably damaging Het
Camk2n2 C A 16: 20,620,198 G72V probably benign Het
Cd276 A T 9: 58,527,562 probably benign Het
Cd2ap G A 17: 42,838,758 Q122* probably null Het
Cdan1 T A 2: 120,731,426 probably benign Het
Cdh3 T C 8: 106,536,915 S156P probably benign Het
Chil4 T A 3: 106,210,643 probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Fcrlb T C 1: 170,907,527 T344A probably benign Het
Fras1 T A 5: 96,713,970 probably benign Het
Fras1 G T 5: 96,764,976 V3380F possibly damaging Het
Galnt9 A G 5: 110,619,253 D530G possibly damaging Het
Gja10 A T 4: 32,601,135 S416R probably benign Het
Gm10549 T A 18: 33,470,788 V108E unknown Het
Gm8298 T C 3: 59,877,150 L348P probably damaging Het
Hook3 A T 8: 26,068,659 L59Q probably damaging Het
Hpf1 T A 8: 60,900,120 D178E probably benign Het
Hsd17b7 T C 1: 169,961,129 N173S possibly damaging Het
Hsph1 A G 5: 149,629,989 F236L probably damaging Het
Kcnk12 G T 17: 87,746,109 T375K probably benign Het
Kdelc2 T C 9: 53,395,850 Y365H probably damaging Het
Klra3 A T 6: 130,327,070 S220T probably damaging Het
Lhx1 A T 11: 84,524,141 L12Q probably damaging Het
Lnx1 A G 5: 74,606,049 L468P probably damaging Het
Ltbp3 T A 19: 5,753,942 C827* probably null Het
Mical1 C T 10: 41,478,214 A53V probably damaging Het
Mmp10 A T 9: 7,506,501 H326L probably benign Het
Muc5b T A 7: 141,865,493 D4004E possibly damaging Het
Myo5b A T 18: 74,577,609 H98L possibly damaging Het
Nbeal1 A G 1: 60,284,092 T2110A probably damaging Het
Nedd4l C A 18: 65,212,791 R825S probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1277 A T 2: 111,270,277 I30N possibly damaging Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr596 T A 7: 103,310,225 L168Q probably damaging Het
Otog A T 7: 46,290,937 probably null Het
Parp2 T A 14: 50,819,379 L320H probably damaging Het
Pola2 C T 19: 5,943,222 probably null Het
Poln A T 5: 34,107,150 probably benign Het
Pomt1 T A 2: 32,241,668 V123E probably damaging Het
Prom2 T C 2: 127,532,882 Y578C probably damaging Het
Prss23 T C 7: 89,510,391 T157A probably damaging Het
Sdk1 T A 5: 141,613,195 V205E probably damaging Het
Sdk1 A G 5: 142,161,926 K1771R probably benign Het
Sidt1 A T 16: 44,281,871 S309T possibly damaging Het
Sirpa T A 2: 129,615,512 F169I probably damaging Het
Slc8a1 T C 17: 81,648,487 N374S probably damaging Het
Sp110 C T 1: 85,596,110 probably null Het
Stard9 A G 2: 120,679,453 probably null Het
Synpr A G 14: 13,563,082 N105S probably damaging Het
Tbc1d16 T C 11: 119,156,101 Y440C probably damaging Het
Trabd A G 15: 89,085,621 I313V possibly damaging Het
Trappc10 T C 10: 78,210,776 R430G probably damaging Het
Trim50 A G 5: 135,358,889 E145G probably benign Het
Uba2 A T 7: 34,163,199 F105I probably damaging Het
Uba3 A G 6: 97,199,269 V92A possibly damaging Het
Uhmk1 T C 1: 170,211,059 K153R probably damaging Het
Vmn2r3 T A 3: 64,275,472 M269L probably benign Het
Vmn2r3 T C 3: 64,287,389 K8R possibly damaging Het
Xpot G T 10: 121,607,638 probably benign Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Zfy1 T A Y: 725,620 H715L possibly damaging Het
Zmym1 A C 4: 127,048,079 L839V probably damaging Het
Other mutations in Mpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Mpl APN 4 118455661 missense possibly damaging 0.94
IGL02096:Mpl APN 4 118457136 missense possibly damaging 0.46
IGL02681:Mpl APN 4 118448871 splice site probably benign
R0238:Mpl UTSW 4 118456863 splice site probably benign
R0309:Mpl UTSW 4 118446038 intron probably benign
R0539:Mpl UTSW 4 118443508 missense possibly damaging 0.68
R0558:Mpl UTSW 4 118444020 missense probably damaging 0.99
R0601:Mpl UTSW 4 118443536 missense probably benign 0.08
R0784:Mpl UTSW 4 118446406 missense possibly damaging 0.59
R1016:Mpl UTSW 4 118448913 missense probably damaging 1.00
R1532:Mpl UTSW 4 118448568 missense possibly damaging 0.63
R1590:Mpl UTSW 4 118444024 missense probably damaging 0.99
R1875:Mpl UTSW 4 118456829 missense probably benign
R1935:Mpl UTSW 4 118455739 missense probably benign 0.01
R2182:Mpl UTSW 4 118457413 missense probably benign
R2291:Mpl UTSW 4 118449000 missense probably benign 0.04
R2508:Mpl UTSW 4 118455757 missense probably damaging 1.00
R4242:Mpl UTSW 4 118456771 missense probably damaging 0.98
R4718:Mpl UTSW 4 118456724 missense probably benign 0.02
R4775:Mpl UTSW 4 118448580 missense probably damaging 1.00
R5158:Mpl UTSW 4 118456684 missense probably damaging 0.98
R5208:Mpl UTSW 4 118455881 missense probably benign 0.00
R5276:Mpl UTSW 4 118455721 missense probably benign
R5953:Mpl UTSW 4 118454510 missense possibly damaging 0.89
R5953:Mpl UTSW 4 118454511 missense probably damaging 0.99
R6439:Mpl UTSW 4 118448553 missense probably damaging 0.98
R6450:Mpl UTSW 4 118448700 splice site probably null
R6521:Mpl UTSW 4 118455117 critical splice donor site probably null
R6812:Mpl UTSW 4 118455264 missense probably benign 0.03
R6876:Mpl UTSW 4 118457120 missense probably damaging 1.00
R7095:Mpl UTSW 4 118444063 missense
R7100:Mpl UTSW 4 118457410 missense
R7173:Mpl UTSW 4 118448544 critical splice donor site probably null
R7177:Mpl UTSW 4 118448544 critical splice donor site probably null
R7512:Mpl UTSW 4 118448892 missense
Predicted Primers PCR Primer
(F):5'- TCAGTGTTATAAAGCCAGAGGG -3'
(R):5'- CTGAGCCACTCCTGGTTAATCTAG -3'

Sequencing Primer
(F):5'- TGGCAACAGAATGGATGGTGTTG -3'
(R):5'- GGTTAATCTAGTTTCTTCTGCTTGAC -3'
Posted On2014-06-23