Incidental Mutation 'R1806:Adarb1'
ID 203477
Institutional Source Beutler Lab
Gene Symbol Adarb1
Ensembl Gene ENSMUSG00000020262
Gene Name adenosine deaminase, RNA-specific, B1
Synonyms RED1, D10Bwg0447e, ADAR2, 1700057H01Rik
MMRRC Submission 039835-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1806 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 77290726-77418270 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77322265 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 116 (N116S)
Ref Sequence ENSEMBL: ENSMUSP00000101046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020496] [ENSMUST00000098374] [ENSMUST00000105404] [ENSMUST00000105406] [ENSMUST00000126073] [ENSMUST00000144547]
AlphaFold Q91ZS8
Predicted Effect probably damaging
Transcript: ENSMUST00000020496
AA Change: N116S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020496
Gene: ENSMUSG00000020262
AA Change: N116S

DomainStartEndE-ValueType
DSRM 79 143 1.9e-22 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 5.8e-21 SMART
ADEAMc 322 698 2.1e-196 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000098374
AA Change: N116S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095976
Gene: ENSMUSG00000020262
AA Change: N116S

DomainStartEndE-ValueType
DSRM 79 143 3.31e-20 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 9.87e-19 SMART
ADEAMc 322 708 1.32e-191 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105404
Predicted Effect probably damaging
Transcript: ENSMUST00000105406
AA Change: N116S

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101046
Gene: ENSMUSG00000020262
AA Change: N116S

DomainStartEndE-ValueType
DSRM 79 143 3.31e-20 SMART
low complexity region 192 213 N/A INTRINSIC
low complexity region 220 231 N/A INTRINSIC
DSRM 236 297 9.87e-19 SMART
ADEAMc 322 708 1.32e-191 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126073
Predicted Effect probably benign
Transcript: ENSMUST00000144547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156583
Meta Mutation Damage Score 0.5294 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: This gene encodes a double-stranded-RNA-specific adenosine deaminase that is involved in editing pre-mRNAs by site-specific conversion of adenosine (A) to inosine (I). Substrates for this enzyme include ionotropic glutamate receptors (GluR2-6) and serotonin receptor (5HT2C). Studies in rodents have shown that this protein can modify its own pre-mRNA by A->I editing to create a novel acceptor splice site, alternative splicing to which results in down regulation of its protein expression. Additional splicing events result in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in progressive seizure susceptibility and death within 20 days of age. Mice homozygous for a conditional allele activated in neurons exhibit motor neuron degeneration, motor function abnormalities, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Adamts15 C A 9: 30,904,815 C616F probably damaging Het
Add2 C T 6: 86,118,657 S437L probably damaging Het
Adra1d T A 2: 131,546,149 R495S probably benign Het
Agk C T 6: 40,387,495 T309I probably damaging Het
Aqr T C 2: 114,161,652 Y81C probably damaging Het
Bak1 G A 17: 27,021,268 Q142* probably null Het
Bckdha A G 7: 25,631,420 V307A probably damaging Het
Camk2n2 C A 16: 20,620,198 G72V probably benign Het
Cd276 A T 9: 58,527,562 probably benign Het
Cd2ap G A 17: 42,838,758 Q122* probably null Het
Cdan1 T A 2: 120,731,426 probably benign Het
Cdh3 T C 8: 106,536,915 S156P probably benign Het
Chil4 T A 3: 106,210,643 probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Fcrlb T C 1: 170,907,527 T344A probably benign Het
Fras1 T A 5: 96,713,970 probably benign Het
Fras1 G T 5: 96,764,976 V3380F possibly damaging Het
Galnt9 A G 5: 110,619,253 D530G possibly damaging Het
Gja10 A T 4: 32,601,135 S416R probably benign Het
Gm10549 T A 18: 33,470,788 V108E unknown Het
Gm8298 T C 3: 59,877,150 L348P probably damaging Het
Hook3 A T 8: 26,068,659 L59Q probably damaging Het
Hpf1 T A 8: 60,900,120 D178E probably benign Het
Hsd17b7 T C 1: 169,961,129 N173S possibly damaging Het
Hsph1 A G 5: 149,629,989 F236L probably damaging Het
Kcnk12 G T 17: 87,746,109 T375K probably benign Het
Kdelc2 T C 9: 53,395,850 Y365H probably damaging Het
Klra3 A T 6: 130,327,070 S220T probably damaging Het
Lhx1 A T 11: 84,524,141 L12Q probably damaging Het
Lnx1 A G 5: 74,606,049 L468P probably damaging Het
Ltbp3 T A 19: 5,753,942 C827* probably null Het
Mical1 C T 10: 41,478,214 A53V probably damaging Het
Mmp10 A T 9: 7,506,501 H326L probably benign Het
Mpl A T 4: 118,443,532 M600K possibly damaging Het
Muc5b T A 7: 141,865,493 D4004E possibly damaging Het
Myo5b A T 18: 74,577,609 H98L possibly damaging Het
Nbeal1 A G 1: 60,284,092 T2110A probably damaging Het
Nedd4l C A 18: 65,212,791 R825S probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1277 A T 2: 111,270,277 I30N possibly damaging Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr596 T A 7: 103,310,225 L168Q probably damaging Het
Otog A T 7: 46,290,937 probably null Het
Parp2 T A 14: 50,819,379 L320H probably damaging Het
Pola2 C T 19: 5,943,222 probably null Het
Poln A T 5: 34,107,150 probably benign Het
Pomt1 T A 2: 32,241,668 V123E probably damaging Het
Prom2 T C 2: 127,532,882 Y578C probably damaging Het
Prss23 T C 7: 89,510,391 T157A probably damaging Het
Sdk1 T A 5: 141,613,195 V205E probably damaging Het
Sdk1 A G 5: 142,161,926 K1771R probably benign Het
Sidt1 A T 16: 44,281,871 S309T possibly damaging Het
Sirpa T A 2: 129,615,512 F169I probably damaging Het
Slc8a1 T C 17: 81,648,487 N374S probably damaging Het
Sp110 C T 1: 85,596,110 probably null Het
Stard9 A G 2: 120,679,453 probably null Het
Synpr A G 14: 13,563,082 N105S probably damaging Het
Tbc1d16 T C 11: 119,156,101 Y440C probably damaging Het
Trabd A G 15: 89,085,621 I313V possibly damaging Het
Trappc10 T C 10: 78,210,776 R430G probably damaging Het
Trim50 A G 5: 135,358,889 E145G probably benign Het
Uba2 A T 7: 34,163,199 F105I probably damaging Het
Uba3 A G 6: 97,199,269 V92A possibly damaging Het
Uhmk1 T C 1: 170,211,059 K153R probably damaging Het
Vmn2r3 T A 3: 64,275,472 M269L probably benign Het
Vmn2r3 T C 3: 64,287,389 K8R possibly damaging Het
Xpot G T 10: 121,607,638 probably benign Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Zfy1 T A Y: 725,620 H715L possibly damaging Het
Zmym1 A C 4: 127,048,079 L839V probably damaging Het
Other mutations in Adarb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Adarb1 APN 10 77322490 missense probably damaging 1.00
IGL01996:Adarb1 APN 10 77322217 missense probably damaging 1.00
IGL02173:Adarb1 APN 10 77321825 missense probably damaging 1.00
IGL02214:Adarb1 APN 10 77322301 missense probably damaging 0.99
IGL02399:Adarb1 APN 10 77295754 missense probably benign 0.02
IGL02699:Adarb1 APN 10 77322019 missense probably benign
IGL02867:Adarb1 APN 10 77313541 missense probably benign 0.01
IGL02889:Adarb1 APN 10 77313541 missense probably benign 0.01
IGL03133:Adarb1 APN 10 77325896 start gained probably benign
R1834:Adarb1 UTSW 10 77317231 splice site probably benign
R2174:Adarb1 UTSW 10 77295798 missense probably benign 0.35
R2233:Adarb1 UTSW 10 77317349 missense probably damaging 1.00
R2234:Adarb1 UTSW 10 77317349 missense probably damaging 1.00
R2908:Adarb1 UTSW 10 77313403 critical splice donor site probably null
R3106:Adarb1 UTSW 10 77321757 missense probably damaging 1.00
R5104:Adarb1 UTSW 10 77322287 missense probably damaging 1.00
R5134:Adarb1 UTSW 10 77325845 intron probably benign
R5497:Adarb1 UTSW 10 77325889 missense probably damaging 0.96
R5869:Adarb1 UTSW 10 77325616 intron probably benign
R6168:Adarb1 UTSW 10 77322319 missense probably damaging 1.00
R7372:Adarb1 UTSW 10 77295878 critical splice acceptor site probably null
R7575:Adarb1 UTSW 10 77303295 missense probably damaging 0.99
R7885:Adarb1 UTSW 10 77295708 missense possibly damaging 0.50
R9227:Adarb1 UTSW 10 77321792 missense probably damaging 1.00
R9230:Adarb1 UTSW 10 77321792 missense probably damaging 1.00
R9350:Adarb1 UTSW 10 77322433 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGCCATTGAAGAGTGTGTCAGG -3'
(R):5'- AGGGTATTCCGCTCTCCAAC -3'

Sequencing Primer
(F):5'- TGTGTCAGGGAAGTCAGCC -3'
(R):5'- TGGTAGCACCAGCAGGAAGC -3'
Posted On 2014-06-23