Mutagenetix > Incidental Mutation

Incidental Mutation 'R1806:Ntn4'

203479

Institutional Source

Beutler Lab

Gene Symbol

Ntn4

Ensembl Gene

ENSMUSG00000020019

Gene Name

netrin 4

Synonyms

beta-netrin

MMRRC Submission

039835-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1806 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93640681-93747207 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 93707353 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Tryptophan at position 314 (R314W)

Ref Sequence

ENSEMBL: ENSMUSP00000020204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020204]

AlphaFold

Q9JI33

Predicted Effect

probably damaging
Transcript: ENSMUST00000020204
AA Change: R314W

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: R314W

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	28	260	6.48e-55	SMART
EGF_Lam	262	329	5.83e-7	SMART
EGF_Lam	332	392	3.32e-11	SMART
EGF_Lam	395	446	3.73e-14	SMART
C345C	516	625	5.58e-25	SMART

Meta Mutation Damage Score

0.6651

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.9%
20x: 91.2%

Validation Efficiency

96% (77/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
Adamts15	C	A	9: 30,904,815	C616F	probably damaging	Het
Adarb1	T	C	10: 77,322,265	N116S	probably damaging	Het
Add2	C	T	6: 86,118,657	S437L	probably damaging	Het
Adra1d	T	A	2: 131,546,149	R495S	probably benign	Het
Agk	C	T	6: 40,387,495	T309I	probably damaging	Het
Aqr	T	C	2: 114,161,652	Y81C	probably damaging	Het
Bak1	G	A	17: 27,021,268	Q142*	probably null	Het
Bckdha	A	G	7: 25,631,420	V307A	probably damaging	Het
Camk2n2	C	A	16: 20,620,198	G72V	probably benign	Het
Cd276	A	T	9: 58,527,562		probably benign	Het
Cd2ap	G	A	17: 42,838,758	Q122*	probably null	Het
Cdan1	T	A	2: 120,731,426		probably benign	Het
Cdh3	T	C	8: 106,536,915	S156P	probably benign	Het
Chil4	T	A	3: 106,210,643		probably benign	Het
Col11a1	C	T	3: 114,158,142	R1074C	probably damaging	Het
Fcrlb	T	C	1: 170,907,527	T344A	probably benign	Het
Fras1	T	A	5: 96,713,970		probably benign	Het
Fras1	G	T	5: 96,764,976	V3380F	possibly damaging	Het
Galnt9	A	G	5: 110,619,253	D530G	possibly damaging	Het
Gja10	A	T	4: 32,601,135	S416R	probably benign	Het
Gm10549	T	A	18: 33,470,788	V108E	unknown	Het
Gm8298	T	C	3: 59,877,150	L348P	probably damaging	Het
Hook3	A	T	8: 26,068,659	L59Q	probably damaging	Het
Hpf1	T	A	8: 60,900,120	D178E	probably benign	Het
Hsd17b7	T	C	1: 169,961,129	N173S	possibly damaging	Het
Hsph1	A	G	5: 149,629,989	F236L	probably damaging	Het
Kcnk12	G	T	17: 87,746,109	T375K	probably benign	Het
Kdelc2	T	C	9: 53,395,850	Y365H	probably damaging	Het
Klra3	A	T	6: 130,327,070	S220T	probably damaging	Het
Lhx1	A	T	11: 84,524,141	L12Q	probably damaging	Het
Lnx1	A	G	5: 74,606,049	L468P	probably damaging	Het
Ltbp3	T	A	19: 5,753,942	C827*	probably null	Het
Mical1	C	T	10: 41,478,214	A53V	probably damaging	Het
Mmp10	A	T	9: 7,506,501	H326L	probably benign	Het
Mpl	A	T	4: 118,443,532	M600K	possibly damaging	Het
Muc5b	T	A	7: 141,865,493	D4004E	possibly damaging	Het
Myo5b	A	T	18: 74,577,609	H98L	possibly damaging	Het
Nbeal1	A	G	1: 60,284,092	T2110A	probably damaging	Het
Nedd4l	C	A	18: 65,212,791	R825S	probably damaging	Het
Olfr1277	A	T	2: 111,270,277	I30N	possibly damaging	Het
Olfr228	A	T	2: 86,483,139	I201N	probably damaging	Het
Olfr596	T	A	7: 103,310,225	L168Q	probably damaging	Het
Otog	A	T	7: 46,290,937		probably null	Het
Parp2	T	A	14: 50,819,379	L320H	probably damaging	Het
Pola2	C	T	19: 5,943,222		probably null	Het
Poln	A	T	5: 34,107,150		probably benign	Het
Pomt1	T	A	2: 32,241,668	V123E	probably damaging	Het
Prom2	T	C	2: 127,532,882	Y578C	probably damaging	Het
Prss23	T	C	7: 89,510,391	T157A	probably damaging	Het
Sdk1	T	A	5: 141,613,195	V205E	probably damaging	Het
Sdk1	A	G	5: 142,161,926	K1771R	probably benign	Het
Sidt1	A	T	16: 44,281,871	S309T	possibly damaging	Het
Sirpa	T	A	2: 129,615,512	F169I	probably damaging	Het
Slc8a1	T	C	17: 81,648,487	N374S	probably damaging	Het
Sp110	C	T	1: 85,596,110		probably null	Het
Stard9	A	G	2: 120,679,453		probably null	Het
Synpr	A	G	14: 13,563,082	N105S	probably damaging	Het
Tbc1d16	T	C	11: 119,156,101	Y440C	probably damaging	Het
Trabd	A	G	15: 89,085,621	I313V	possibly damaging	Het
Trappc10	T	C	10: 78,210,776	R430G	probably damaging	Het
Trim50	A	G	5: 135,358,889	E145G	probably benign	Het
Uba2	A	T	7: 34,163,199	F105I	probably damaging	Het
Uba3	A	G	6: 97,199,269	V92A	possibly damaging	Het
Uhmk1	T	C	1: 170,211,059	K153R	probably damaging	Het
Vmn2r3	T	A	3: 64,275,472	M269L	probably benign	Het
Vmn2r3	T	C	3: 64,287,389	K8R	possibly damaging	Het
Xpot	G	T	10: 121,607,638		probably benign	Het
Zfp128	A	G	7: 12,891,022	Y439C	probably benign	Het
Zfy1	T	A	Y: 725,620	H715L	possibly damaging	Het
Zmym1	A	C	4: 127,048,079	L839V	probably damaging	Het

Other mutations in Ntn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02052:Ntn4	APN	10	93707349	missense	probably damaging	1.00
IGL02212:Ntn4	APN	10	93644849	missense	possibly damaging	0.50
IGL02698:Ntn4	APN	10	93644659	missense	probably benign	0.19
IGL02752:Ntn4	APN	10	93710559	missense	possibly damaging	0.84
PIT4468001:Ntn4	UTSW	10	93644725	missense	probably damaging	0.99
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0132:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0419:Ntn4	UTSW	10	93682429	missense	probably benign	0.04
R1304:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1306:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1307:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1308:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1619:Ntn4	UTSW	10	93644734	missense	probably damaging	1.00
R1645:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1664:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1695:Ntn4	UTSW	10	93733602	splice site	probably null
R1796:Ntn4	UTSW	10	93745771	missense	probably damaging	1.00
R1845:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1856:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1872:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1879:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1901:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1902:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1925:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1926:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1927:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2060:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2113:Ntn4	UTSW	10	93644839	missense	probably damaging	1.00
R2202:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2203:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2975:Ntn4	UTSW	10	93644891	missense	probably damaging	1.00
R4277:Ntn4	UTSW	10	93741210	missense	possibly damaging	0.95
R4805:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4806:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4807:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R5818:Ntn4	UTSW	10	93644764	missense	probably benign	0.40
R6048:Ntn4	UTSW	10	93707266	splice site	probably null
R6051:Ntn4	UTSW	10	93745795	missense	probably benign
R6346:Ntn4	UTSW	10	93644861	missense	probably damaging	1.00
R6752:Ntn4	UTSW	10	93734175	missense	probably benign
R7196:Ntn4	UTSW	10	93733714	missense	probably benign	0.01
R7240:Ntn4	UTSW	10	93745741	missense	probably damaging	0.99
R7365:Ntn4	UTSW	10	93644804	missense	probably damaging	1.00
R7374:Ntn4	UTSW	10	93682572	missense	probably benign
R7505:Ntn4	UTSW	10	93707284	missense	probably damaging	1.00
R7509:Ntn4	UTSW	10	93710568	missense	probably benign	0.01
R7726:Ntn4	UTSW	10	93733682	missense	possibly damaging	0.82
R7957:Ntn4	UTSW	10	93644473	splice site	probably benign
R8092:Ntn4	UTSW	10	93741056	missense	probably damaging	0.97
R8202:Ntn4	UTSW	10	93644903	missense	possibly damaging	0.88
R8508:Ntn4	UTSW	10	93741104	missense	possibly damaging	0.48
R9010:Ntn4	UTSW	10	93644644	missense
R9115:Ntn4	UTSW	10	93733813	missense	probably benign
R9415:Ntn4	UTSW	10	93644626	missense	probably benign	0.00
RF045:Ntn4	UTSW	10	93710625	missense	possibly damaging	0.95
X0024:Ntn4	UTSW	10	93644971	missense	probably damaging	1.00
Z1176:Ntn4	UTSW	10	93741153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTTACAGATAAATGGGTATGAAG -3'
(R):5'- ACATTCTTGGCTACTCAGGCC -3'

Sequencing Primer
(F):5'- AAGAAGTTGAAGGGAGGGTTTCTTTC -3'
(R):5'- ACTGCAGGCTGTTTCCAACG -3'

Posted On

2014-06-23