Incidental Mutation 'R0110:Stam2'
ID20348
Institutional Source Beutler Lab
Gene Symbol Stam2
Ensembl Gene ENSMUSG00000055371
Gene Namesignal transducing adaptor molecule (SH3 domain and ITAM motif) 2
SynonymsHbp, 1200004O12Rik, 5730456G07Rik
MMRRC Submission 038396-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0110 (G1)
Quality Score187
Status Validated
Chromosome2
Chromosomal Location52691664-52742281 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 52719986 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102759] [ENSMUST00000127316] [ENSMUST00000138290] [ENSMUST00000155516]
Predicted Effect probably benign
Transcript: ENSMUST00000102759
SMART Domains Protein: ENSMUSP00000099820
Gene: ENSMUSG00000055371

DomainStartEndE-ValueType
VHS 9 140 6.36e-57 SMART
UIM 165 184 3.24e-3 SMART
SH3 205 260 5.69e-21 SMART
Pfam:GAT 294 367 2.3e-8 PFAM
low complexity region 502 515 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127316
SMART Domains Protein: ENSMUSP00000121898
Gene: ENSMUSG00000055371

DomainStartEndE-ValueType
Pfam:VHS 4 70 8.5e-20 PFAM
UIM 132 151 3.24e-3 SMART
SH3 172 227 5.69e-21 SMART
PDB:3F1I|C 258 334 4e-29 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000138290
SMART Domains Protein: ENSMUSP00000114620
Gene: ENSMUSG00000055371

DomainStartEndE-ValueType
Pfam:VHS 1 65 7.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150582
Predicted Effect probably benign
Transcript: ENSMUST00000155516
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is closely related to STAM, an adaptor protein involved in the downstream signaling of cytokine receptors, both of which contain a SH3 domain and the immunoreceptor tyrosine-based activation motif (ITAM). Similar to STAM, this protein acts downstream of JAK kinases, and is phosphorylated in response to cytokine stimulation. This protein and STAM thus are thought to exhibit compensatory effects on the signaling pathway downstream of JAK kinases upon cytokine stimulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal lymphocyte responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,506 probably benign Het
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arpc1b T A 5: 145,127,715 W361R probably damaging Het
Baiap2l1 T C 5: 144,275,891 Y438C probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cntln C T 4: 85,096,757 T1095I probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dnah12 A G 14: 26,798,899 R1892G probably damaging Het
Dock4 A G 12: 40,621,312 probably benign Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Fam227b T A 2: 126,100,921 S319C probably damaging Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Gal3st2c C T 1: 94,009,497 P388L probably benign Het
Ggn C T 7: 29,171,296 P47S probably damaging Het
Gli3 T G 13: 15,724,785 L919R probably damaging Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 C A 1: 44,059,224 V905F probably benign Het
Gmip C T 8: 69,815,609 probably benign Het
Gpr39 C T 1: 125,677,500 T55M probably damaging Het
Grk4 A G 5: 34,716,213 T208A probably damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hadhb T C 5: 30,169,485 probably benign Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpa A T 2: 130,679,418 probably benign Het
Klhl10 A G 11: 100,456,932 T605A probably benign Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lap3 T C 5: 45,495,290 probably benign Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map3k6 T C 4: 133,243,794 L273P probably damaging Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mrc1 T A 2: 14,238,542 probably benign Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtcl1 C T 17: 66,358,114 E1149K possibly damaging Het
Naca C T 10: 128,044,790 A1897V probably benign Het
Ncapg T C 5: 45,693,147 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pla2g4a T A 1: 149,840,647 M688L possibly damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Prmt1 A G 7: 44,978,801 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Prom2 T G 2: 127,531,113 S679R possibly damaging Het
Psen2 T C 1: 180,238,914 T153A probably damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Tas2r123 T C 6: 132,847,332 V64A probably benign Het
Tnnc1 A G 14: 31,211,408 D149G probably damaging Het
Tpp2 A G 1: 43,999,693 D1133G probably damaging Het
Tpp2 T A 1: 43,978,504 V756E probably benign Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Tsen15 A G 1: 152,371,797 V148A probably damaging Het
Ttn T A 2: 76,864,328 probably benign Het
Ube2u A G 4: 100,486,673 I90V probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Wdr41 T C 13: 95,018,111 probably benign Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp423 A G 8: 87,782,259 S486P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Other mutations in Stam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Stam2 APN 2 52706406 missense possibly damaging 0.80
IGL00471:Stam2 APN 2 52720935 missense probably damaging 1.00
IGL01480:Stam2 APN 2 52716439 missense probably benign
IGL01731:Stam2 APN 2 52708150 missense probably damaging 0.99
IGL02684:Stam2 APN 2 52719935 missense probably damaging 1.00
IGL02893:Stam2 APN 2 52714902 missense probably damaging 1.00
IGL02900:Stam2 APN 2 52708197 missense probably benign
R0257:Stam2 UTSW 2 52694782 missense possibly damaging 0.90
R0539:Stam2 UTSW 2 52703256 splice site probably benign
R1432:Stam2 UTSW 2 52714809 splice site probably benign
R1699:Stam2 UTSW 2 52703175 missense possibly damaging 0.55
R1822:Stam2 UTSW 2 52716527 missense probably damaging 1.00
R1956:Stam2 UTSW 2 52708227 critical splice acceptor site probably null
R1984:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1985:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1986:Stam2 UTSW 2 52709626 missense possibly damaging 0.71
R1993:Stam2 UTSW 2 52703156 nonsense probably null
R2179:Stam2 UTSW 2 52694924 missense probably benign 0.00
R2181:Stam2 UTSW 2 52703144 missense probably benign 0.00
R4617:Stam2 UTSW 2 52715704 missense probably benign 0.00
R4723:Stam2 UTSW 2 52720950 missense probably benign 0.10
R5217:Stam2 UTSW 2 52736293 intron probably benign
R5218:Stam2 UTSW 2 52736293 intron probably benign
R5219:Stam2 UTSW 2 52736293 intron probably benign
R5366:Stam2 UTSW 2 52736293 intron probably benign
R5368:Stam2 UTSW 2 52736293 intron probably benign
R5420:Stam2 UTSW 2 52736293 intron probably benign
R5447:Stam2 UTSW 2 52736293 intron probably benign
R5490:Stam2 UTSW 2 52720917 missense probably damaging 1.00
R5799:Stam2 UTSW 2 52720910 nonsense probably null
R5861:Stam2 UTSW 2 52742104 utr 5 prime probably benign
R6039:Stam2 UTSW 2 52709599 missense probably benign
R6039:Stam2 UTSW 2 52709599 missense probably benign
R6490:Stam2 UTSW 2 52720942 missense probably benign 0.00
R6552:Stam2 UTSW 2 52708227 critical splice acceptor site probably null
R6792:Stam2 UTSW 2 52707981 missense probably benign
R7787:Stam2 UTSW 2 52706406 missense probably benign 0.01
R8042:Stam2 UTSW 2 52706397 critical splice donor site unknown
R8050:Stam2 UTSW 2 52719773 missense not run
R8074:Stam2 UTSW 2 52706426 missense not run
Predicted Primers PCR Primer
(F):5'- GTTTGCCACACAAGCTCCAAGAAG -3'
(R):5'- AGGCTTTGCTGACAGAAAAGTCCG -3'

Sequencing Primer
(F):5'- GGGTCATCTGACATGTCGTT -3'
(R):5'- GACAGAAAAGTCCGTCTTTCTGG -3'
Posted On2013-04-11