Mutagenetix > Incidental Mutation

Incidental Mutation 'R1807:Atrn'

203508

Institutional Source

Beutler Lab

Gene Symbol

Atrn

Ensembl Gene

ENSMUSG00000027312

Gene Name

attractin

Synonyms

Mgca

MMRRC Submission

039836-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1807 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130906495-131030333 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 130982772 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1042 (N1042S)

Ref Sequence

ENSEMBL: ENSMUSP00000028781 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028781]

AlphaFold

Q9WU60

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028781
AA Change: N1042S

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: N1042S

Domain	Start	End	E-Value	Type
low complexity region	2	9	N/A	INTRINSIC
low complexity region	51	97	N/A	INTRINSIC
EGF	99	129	9.85e-5	SMART
CUB	131	247	7.85e-18	SMART
EGF	248	282	1.47e1	SMART
Pfam:Kelch_1	339	382	1.1e-7	PFAM
Pfam:Kelch_5	389	434	2.5e-7	PFAM
Pfam:Kelch_6	390	439	3.3e-8	PFAM
Pfam:Kelch_1	553	606	8.4e-8	PFAM
PSI	646	693	7.41e-7	SMART
PSI	702	747	8.64e-8	SMART
PSI	754	799	2.11e-2	SMART
CLECT	787	918	6.14e-20	SMART
PSI	931	982	1.11e-5	SMART
PSI	985	1060	1.2e-6	SMART
EGF_Lam	1062	1105	1.97e-4	SMART
EGF_like	1108	1154	3.9e0	SMART
transmembrane domain	1278	1300	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
low complexity region	1373	1385	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132557

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134964

Meta Mutation Damage Score

0.0697

Coding Region Coverage

1x: 97.4%
3x: 96.7%
10x: 94.7%
20x: 90.7%

Validation Efficiency

97% (77/79)

MGI Phenotype

FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310061I04Rik	C	T	17: 35,895,069	W27*	probably null	Het
4933425L06Rik	A	T	13: 105,082,236	Q26L	probably benign	Het
4933430I17Rik	T	A	4: 62,542,756	Y289*	probably null	Het
8430408G22Rik	G	A	6: 116,651,722	V9M	possibly damaging	Het
A3galt2	A	G	4: 128,767,601	I348V	probably benign	Het
Abca13	A	G	11: 9,291,755	Y1206C	probably damaging	Het
Adar	T	C	3: 89,734,865	S18P	probably benign	Het
Akr1cl	T	C	1: 65,021,947	D139G	possibly damaging	Het
Aldh1b1	A	G	4: 45,802,873	Y137C	possibly damaging	Het
Arsa	T	C	15: 89,475,322	M86V	possibly damaging	Het
Atg9b	C	A	5: 24,387,057	R648L	probably damaging	Het
Ccdc130	C	T	8: 84,260,307	R187Q	probably damaging	Het
Ccdc6	T	A	10: 70,175,159	D325E	possibly damaging	Het
Cdk12	T	C	11: 98,210,377	S354P	unknown	Het
Chst3	T	A	10: 60,186,308	Y239F	probably benign	Het
Cilp2	C	A	8: 69,882,194	R718L	probably damaging	Het
Col27a1	A	G	4: 63,331,349		probably benign	Het
Ctbp2	T	C	7: 133,014,408	N266S	probably benign	Het
Ctnnd2	T	C	15: 30,619,871	V123A	probably damaging	Het
D7Ertd443e	T	A	7: 134,293,305	E552V	probably null	Het
Dcst1	T	A	3: 89,353,541	H516L	probably damaging	Het
Drd2	C	T	9: 49,405,067	L376F	probably damaging	Het
Edn1	A	G	13: 42,306,794	N175S	probably damaging	Het
Eipr1	G	T	12: 28,766,839	G65V	probably damaging	Het
Epha4	G	A	1: 77,374,904	P905S	probably benign	Het
Erbb2	T	C	11: 98,428,854	Y591H	probably damaging	Het
Fam135b	G	A	15: 71,463,912	R478C	probably benign	Het
Fam49a	G	A	12: 12,361,504	R123Q	probably benign	Het
Fat2	T	C	11: 55,289,259	T1419A	probably damaging	Het
Flnb	C	T	14: 7,934,645	T2239I	probably benign	Het
Gm7713	T	C	15: 59,994,471		noncoding transcript	Het
Gm9008	A	G	6: 76,497,414	V73A	probably benign	Het
Hsf5	C	T	11: 87,657,342	P617L	probably benign	Het
Kcnk12	C	A	17: 87,746,040	R398L	probably benign	Het
Kif21b	T	A	1: 136,147,793	N219K	possibly damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Klra5	A	T	6: 129,899,420	F141L	probably benign	Het
Lmtk3	C	T	7: 45,793,278	P462S	probably benign	Het
Mast2	A	G	4: 116,310,741		probably benign	Het
Me1	T	A	9: 86,650,879	T197S	probably damaging	Het
Msr1	T	A	8: 39,619,907	Q267L	probably benign	Het
Nfic	T	C	10: 81,404,985	T328A	probably benign	Het
Nphp3	G	A	9: 104,020,741	D390N	probably benign	Het
Nr2e1	T	A	10: 42,582,909		probably null	Het
Olfr1094	T	A	2: 86,829,101	F116L	probably benign	Het
Olfr603	T	A	7: 103,383,583	N140Y	probably benign	Het
Pard6b	T	C	2: 168,087,412	L46P	probably damaging	Het
Prkaa1	T	A	15: 5,143,954	L20Q	probably damaging	Het
Rapgefl1	T	C	11: 98,845,989		probably null	Het
Recql5	T	C	11: 115,895,115	K611E	possibly damaging	Het
Rexo1	A	T	10: 80,542,579	I1180N	possibly damaging	Het
Rph3a	T	C	5: 120,945,393	N605D	probably damaging	Het
Sema6a	A	G	18: 47,276,424	V592A	possibly damaging	Het
Skint11	A	T	4: 114,194,696	R80S	probably benign	Het
Smpdl3a	C	A	10: 57,801,022	P72H	probably damaging	Het
Sobp	T	G	10: 43,160,826	M39L	possibly damaging	Het
Sparcl1	T	A	5: 104,085,761	Y574F	probably damaging	Het
Spns3	C	T	11: 72,538,340	W206*	probably null	Het
Srf	A	G	17: 46,553,759	V190A	possibly damaging	Het
Stag1	T	G	9: 100,908,666	H742Q	probably benign	Het
Strn3	A	T	12: 51,627,203	S542T	probably benign	Het
Synpo2	T	C	3: 123,080,257	E1020G	possibly damaging	Het
Tcerg1l	T	A	7: 138,395,097	H137L	probably benign	Het
Tlr12	A	T	4: 128,617,436	D340E	probably benign	Het
Tmem130	T	A	5: 144,755,364	T77S	probably benign	Het
Tmem143	C	A	7: 45,897,613	R68S	probably damaging	Het
Tnrc6a	CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT	CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT	7: 123,162,446		probably benign	Het
Trem1	G	T	17: 48,241,635	G67*	probably null	Het
Tsc1	A	G	2: 28,686,113	D978G	probably benign	Het
Txndc9	A	T	1: 37,994,015	H95Q	probably damaging	Het
Zfp35	T	A	18: 24,003,929	N443K	probably benign	Het

Other mutations in Atrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Atrn	APN	2	130958079	missense	probably damaging	1.00
IGL00571:Atrn	APN	2	130995048	missense	probably damaging	1.00
IGL01092:Atrn	APN	2	130947636	nonsense	probably null
IGL01572:Atrn	APN	2	131002795	missense	probably damaging	1.00
IGL01924:Atrn	APN	2	130935565	missense	probably damaging	1.00
IGL02116:Atrn	APN	2	130958089	missense	probably damaging	1.00
IGL02372:Atrn	APN	2	131002754	splice site	probably benign
IGL02390:Atrn	APN	2	131020977	missense	possibly damaging	0.82
IGL02548:Atrn	APN	2	130972282	missense	probably damaging	1.00
IGL02749:Atrn	APN	2	130970144	nonsense	probably null
IGL02749:Atrn	APN	2	130947734	splice site	probably benign
BB010:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
BB020:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R0026:Atrn	UTSW	2	130957920	missense	probably damaging	1.00
R0403:Atrn	UTSW	2	130906859	missense	probably damaging	1.00
R0479:Atrn	UTSW	2	130999165	nonsense	probably null
R0544:Atrn	UTSW	2	130986826	missense	probably damaging	1.00
R0570:Atrn	UTSW	2	130980134	missense	probably benign	0.01
R0606:Atrn	UTSW	2	130906856	missense	possibly damaging	0.90
R0617:Atrn	UTSW	2	130995085	critical splice donor site	probably null
R0658:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R1108:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1112:Atrn	UTSW	2	130999161	missense	probably benign	0.04
R1219:Atrn	UTSW	2	131021007	missense	possibly damaging	0.90
R1422:Atrn	UTSW	2	130957914	missense	probably damaging	1.00
R1524:Atrn	UTSW	2	130957080	missense	probably benign	0.15
R1653:Atrn	UTSW	2	130935624	missense	probably benign
R1795:Atrn	UTSW	2	130972288	missense	probably benign
R1920:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1921:Atrn	UTSW	2	130995051	missense	probably damaging	1.00
R1935:Atrn	UTSW	2	130958035	missense	probably damaging	1.00
R1982:Atrn	UTSW	2	130970222	missense	probably benign
R2000:Atrn	UTSW	2	130935588	missense	probably damaging	1.00
R2143:Atrn	UTSW	2	130957996	missense	probably benign	0.03
R2336:Atrn	UTSW	2	130957954	missense	probably damaging	1.00
R2679:Atrn	UTSW	2	130961675	critical splice donor site	probably null
R3426:Atrn	UTSW	2	131020956	missense	probably benign	0.06
R3909:Atrn	UTSW	2	130994207	missense	probably damaging	1.00
R4077:Atrn	UTSW	2	130964930	critical splice donor site	probably null
R4162:Atrn	UTSW	2	130994228	splice site	probably benign
R4195:Atrn	UTSW	2	130933412	missense	probably damaging	1.00
R4364:Atrn	UTSW	2	130970208	missense	probably benign	0.39
R4465:Atrn	UTSW	2	130960468	missense	probably benign	0.08
R4510:Atrn	UTSW	2	130935577	nonsense	probably null
R4511:Atrn	UTSW	2	130935577	nonsense	probably null
R4527:Atrn	UTSW	2	130973504	missense	probably benign	0.10
R4586:Atrn	UTSW	2	130982042	missense	probably damaging	1.00
R4592:Atrn	UTSW	2	130999130	intron	probably benign
R4658:Atrn	UTSW	2	130933429	missense	probably damaging	1.00
R4735:Atrn	UTSW	2	131020990	missense	probably benign	0.06
R4960:Atrn	UTSW	2	130995047	nonsense	probably null
R4999:Atrn	UTSW	2	130975954	missense	probably damaging	1.00
R5066:Atrn	UTSW	2	130994193	missense	possibly damaging	0.60
R5080:Atrn	UTSW	2	130970124	missense	possibly damaging	0.95
R5141:Atrn	UTSW	2	130999130	intron	probably benign
R5256:Atrn	UTSW	2	130946019	missense	probably benign	0.39
R5494:Atrn	UTSW	2	131023075	missense	probably damaging	1.00
R5678:Atrn	UTSW	2	130970016	missense	probably damaging	0.96
R5752:Atrn	UTSW	2	130906544	unclassified	probably benign
R5931:Atrn	UTSW	2	130933436	missense	possibly damaging	0.56
R6023:Atrn	UTSW	2	131020980	missense	probably benign	0.25
R6176:Atrn	UTSW	2	130946091	missense	probably benign	0.31
R6377:Atrn	UTSW	2	130979969	missense	probably damaging	1.00
R6433:Atrn	UTSW	2	131023027	missense	probably damaging	1.00
R7226:Atrn	UTSW	2	130986744	missense	probably damaging	0.99
R7402:Atrn	UTSW	2	130947600	missense	probably damaging	1.00
R7541:Atrn	UTSW	2	130961571	missense	possibly damaging	0.46
R7587:Atrn	UTSW	2	130980114	missense	probably damaging	1.00
R7872:Atrn	UTSW	2	130970227	critical splice donor site	probably null
R7910:Atrn	UTSW	2	130964887	missense	probably benign	0.04
R7913:Atrn	UTSW	2	130970211	missense	probably damaging	1.00
R7933:Atrn	UTSW	2	130995066	missense	probably damaging	1.00
R8044:Atrn	UTSW	2	130935529	missense	probably damaging	1.00
R8079:Atrn	UTSW	2	131013641	missense	probably null	1.00
R8093:Atrn	UTSW	2	130975988	missense	probably benign	0.00
R8203:Atrn	UTSW	2	130960549	missense	probably benign	0.00
R8234:Atrn	UTSW	2	131023000	critical splice acceptor site	probably null
R8462:Atrn	UTSW	2	130935584	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	130906878	missense	probably damaging	1.00
R8816:Atrn	UTSW	2	131004574	missense	probably damaging	1.00
R8831:Atrn	UTSW	2	130906601	missense	probably benign	0.22
R8937:Atrn	UTSW	2	130999237	missense	probably benign	0.00
R9161:Atrn	UTSW	2	130935550	missense	probably damaging	1.00
R9722:Atrn	UTSW	2	130961616	missense	probably damaging	1.00
R9786:Atrn	UTSW	2	130944889	missense	probably damaging	1.00
RF009:Atrn	UTSW	2	130906922	missense	probably benign	0.12
X0024:Atrn	UTSW	2	130958139	missense	probably damaging	1.00
Z1088:Atrn	UTSW	2	130973399	missense	probably benign
Z1176:Atrn	UTSW	2	130946193	missense	probably benign	0.27
Z1177:Atrn	UTSW	2	130946042	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AAATTGCTCTGGCTACTGTACC -3'
(R):5'- AAGCTTCTGTGCAACCAAAG -3'

Sequencing Primer
(F):5'- TGGCTACTGTACCTGCAGC -3'
(R):5'- TTTGCCAGCTATGATCCAACAAGG -3'

Posted On

2014-06-23