Incidental Mutation 'R0110:Prom2'
ID 20351
Institutional Source Beutler Lab
Gene Symbol Prom2
Ensembl Gene ENSMUSG00000027376
Gene Name prominin 2
Synonyms
MMRRC Submission 038396-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0110 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 127368873-127383337 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 127373033 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 679 (S679R)
Ref Sequence ENSEMBL: ENSMUSP00000099503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028855] [ENSMUST00000103214]
AlphaFold Q3UUY6
Predicted Effect possibly damaging
Transcript: ENSMUST00000028855
AA Change: S679R

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028855
Gene: ENSMUSG00000027376
AA Change: S679R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Prominin 25 808 3.6e-279 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103214
AA Change: S679R

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099503
Gene: ENSMUSG00000027376
AA Change: S679R

DomainStartEndE-ValueType
Pfam:Prominin 18 818 3e-288 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140156
Meta Mutation Damage Score 0.2645 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the prominin family of pentaspan membrane glycoproteins. The encoded protein localizes to basal epithelial cells and may be involved in the organization of plasma membrane microdomains. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutant mice exhibited signs of anemia, with decreased mean red blood cell count and decreased mean hemoglobin and hematocrit levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 61,001,320 (GRCm39) probably benign Het
Abcg3 A G 5: 105,125,482 (GRCm39) I67T probably damaging Het
Adam10 T A 9: 70,655,530 (GRCm39) W333R probably damaging Het
Ahnak C T 19: 8,995,596 (GRCm39) R5627* probably null Het
AI606181 A C 19: 41,582,170 (GRCm39) K113N unknown Het
Alms1 A T 6: 85,597,351 (GRCm39) R1195* probably null Het
Ankrd11 T C 8: 123,618,914 (GRCm39) D1646G possibly damaging Het
Ap2m1 T A 16: 20,360,990 (GRCm39) I334N possibly damaging Het
Arpc1b T A 5: 145,064,525 (GRCm39) W361R probably damaging Het
Baiap2l1 T C 5: 144,212,701 (GRCm39) Y438C probably damaging Het
Brd8dc A T 18: 34,729,204 (GRCm39) D42E probably damaging Het
Ccdc110 T A 8: 46,388,194 (GRCm39) N50K probably benign Het
Ccdc168 C A 1: 44,098,384 (GRCm39) V905F probably benign Het
Cdhr1 T C 14: 36,802,633 (GRCm39) Y610C probably damaging Het
Celsr3 G A 9: 108,704,204 (GRCm39) C229Y possibly damaging Het
Clca4b A T 3: 144,619,112 (GRCm39) Y676N probably damaging Het
Cntln C T 4: 85,014,994 (GRCm39) T1095I probably damaging Het
Cog2 T C 8: 125,255,797 (GRCm39) probably null Het
Col11a1 A T 3: 113,899,105 (GRCm39) probably benign Het
Cpe T A 8: 65,064,501 (GRCm39) I233F probably damaging Het
Dcaf11 T C 14: 55,806,537 (GRCm39) V446A probably damaging Het
Defa34 A G 8: 22,155,988 (GRCm39) probably null Het
Dnah12 A G 14: 26,520,856 (GRCm39) R1892G probably damaging Het
Dock4 A G 12: 40,671,311 (GRCm39) probably benign Het
Dync1h1 C A 12: 110,606,378 (GRCm39) Q2483K probably benign Het
Enpp3 A T 10: 24,652,679 (GRCm39) D759E probably damaging Het
Epyc A G 10: 97,485,625 (GRCm39) T22A probably benign Het
Fam227b T A 2: 125,942,841 (GRCm39) S319C probably damaging Het
Fam83a C A 15: 57,873,322 (GRCm39) Q384K probably benign Het
Fam83b G T 9: 76,400,108 (GRCm39) L332I possibly damaging Het
Gal3st2c C T 1: 93,937,219 (GRCm39) P388L probably benign Het
Ggn C T 7: 28,870,721 (GRCm39) P47S probably damaging Het
Gli3 T G 13: 15,899,370 (GRCm39) L919R probably damaging Het
Gm5134 C A 10: 75,810,079 (GRCm39) T120N probably benign Het
Gmip C T 8: 70,268,259 (GRCm39) probably benign Het
Gpr39 C T 1: 125,605,237 (GRCm39) T55M probably damaging Het
Grk4 A G 5: 34,873,557 (GRCm39) T208A probably damaging Het
Gsdme C A 6: 50,223,107 (GRCm39) probably benign Het
Gucy2e T C 11: 69,126,402 (GRCm39) D326G probably benign Het
Hadhb T C 5: 30,374,483 (GRCm39) probably benign Het
Hectd4 T A 5: 121,419,959 (GRCm39) Y635N possibly damaging Het
Hectd4 G A 5: 121,443,736 (GRCm39) E1319K possibly damaging Het
Ikbkb A T 8: 23,161,651 (GRCm39) C412* probably null Het
Itpa A T 2: 130,521,338 (GRCm39) probably benign Het
Klhl10 A G 11: 100,347,758 (GRCm39) T605A probably benign Het
Krt74 T C 15: 101,671,751 (GRCm39) noncoding transcript Het
Krt81 C A 15: 101,361,508 (GRCm39) R24L possibly damaging Het
Lap3 T C 5: 45,652,632 (GRCm39) probably benign Het
Lrrc10 T A 10: 116,881,695 (GRCm39) L123Q probably damaging Het
Map3k6 T C 4: 132,971,105 (GRCm39) L273P probably damaging Het
Mbl1 A G 14: 40,880,706 (GRCm39) N198S probably damaging Het
Mcf2l A G 8: 13,047,337 (GRCm39) D233G probably damaging Het
Mdga2 T C 12: 66,517,700 (GRCm39) K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 (GRCm39) N3524S probably benign Het
Mrc1 T A 2: 14,243,353 (GRCm39) probably benign Het
Msto1 A G 3: 88,818,848 (GRCm39) L269P probably benign Het
Mtcl1 C T 17: 66,665,109 (GRCm39) E1149K possibly damaging Het
Naca C T 10: 127,880,659 (GRCm39) A1897V probably benign Het
Ncapg T C 5: 45,850,489 (GRCm39) probably benign Het
Neb A T 2: 52,180,755 (GRCm39) probably benign Het
Or5p5 T C 7: 107,413,895 (GRCm39) Y35H probably damaging Het
Or8b12i T C 9: 20,082,561 (GRCm39) Y102C probably benign Het
Or8g27 G A 9: 39,129,024 (GRCm39) V124I possibly damaging Het
Parp2 T A 14: 51,057,130 (GRCm39) Y361N probably damaging Het
Parp3 A G 9: 106,348,995 (GRCm39) F466L possibly damaging Het
Pcdh15 A T 10: 74,126,808 (GRCm39) N296Y probably damaging Het
Pcf11 G A 7: 92,307,039 (GRCm39) P1043L probably damaging Het
Pdzrn3 A T 6: 101,128,014 (GRCm39) I884N probably damaging Het
Phf24 G T 4: 42,933,761 (GRCm39) V48L possibly damaging Het
Pla2g4a T A 1: 149,716,398 (GRCm39) M688L possibly damaging Het
Plcl2 T C 17: 50,915,010 (GRCm39) L673P probably damaging Het
Ppp1r3c A T 19: 36,711,617 (GRCm39) F51Y possibly damaging Het
Prmt1 A G 7: 44,628,225 (GRCm39) probably benign Het
Proc G A 18: 32,258,171 (GRCm39) T258I probably benign Het
Psen2 T C 1: 180,066,479 (GRCm39) T153A probably damaging Het
Rem2 T C 14: 54,713,754 (GRCm39) probably benign Het
Rin2 A G 2: 145,702,953 (GRCm39) K550E probably benign Het
Rtn4 T A 11: 29,683,849 (GRCm39) probably benign Het
Semp2l1 T A 1: 32,584,956 (GRCm39) N318I possibly damaging Het
Ssh1 A T 5: 114,084,766 (GRCm39) D448E probably benign Het
Ssmem1 A T 6: 30,519,547 (GRCm39) probably null Het
Stam2 A T 2: 52,609,998 (GRCm39) probably benign Het
Syne1 A G 10: 5,317,600 (GRCm39) L498P probably damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,144,734 (GRCm39) probably null Het
Taf6l G T 19: 8,755,885 (GRCm39) H254Q probably benign Het
Tas2r123 T C 6: 132,824,295 (GRCm39) V64A probably benign Het
Tnnc1 A G 14: 30,933,365 (GRCm39) D149G probably damaging Het
Tpp2 A G 1: 44,038,853 (GRCm39) D1133G probably damaging Het
Tpp2 T A 1: 44,017,664 (GRCm39) V756E probably benign Het
Traf3ip3 T A 1: 192,860,539 (GRCm39) probably null Het
Tsen15 A G 1: 152,247,548 (GRCm39) V148A probably damaging Het
Ttn T A 2: 76,694,672 (GRCm39) probably benign Het
Ube2u A G 4: 100,343,870 (GRCm39) I90V probably benign Het
Unc79 T A 12: 103,045,329 (GRCm39) probably null Het
Usp47 T C 7: 111,655,787 (GRCm39) S155P possibly damaging Het
Wdr41 T C 13: 95,154,619 (GRCm39) probably benign Het
Zfp217 C T 2: 169,957,382 (GRCm39) A539T probably benign Het
Zfp423 A G 8: 88,508,887 (GRCm39) S486P possibly damaging Het
Zfp628 A T 7: 4,922,732 (GRCm39) Q318L probably benign Het
Other mutations in Prom2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Prom2 APN 2 127,383,059 (GRCm39) missense probably benign 0.04
IGL01140:Prom2 APN 2 127,373,125 (GRCm39) splice site probably benign
IGL01300:Prom2 APN 2 127,377,009 (GRCm39) missense probably benign 0.44
IGL01445:Prom2 APN 2 127,381,433 (GRCm39) splice site probably benign
IGL01472:Prom2 APN 2 127,374,802 (GRCm39) missense probably benign 0.39
IGL01541:Prom2 APN 2 127,371,050 (GRCm39) critical splice donor site probably null
IGL01991:Prom2 APN 2 127,371,142 (GRCm39) missense probably damaging 1.00
IGL02421:Prom2 APN 2 127,373,802 (GRCm39) critical splice acceptor site probably null
IGL02557:Prom2 APN 2 127,371,391 (GRCm39) missense possibly damaging 0.85
IGL02724:Prom2 APN 2 127,380,577 (GRCm39) splice site probably benign
IGL02826:Prom2 APN 2 127,373,036 (GRCm39) missense probably benign 0.07
IGL02830:Prom2 APN 2 127,376,989 (GRCm39) missense possibly damaging 0.88
IGL02990:Prom2 APN 2 127,370,734 (GRCm39) missense probably benign 0.10
R0133:Prom2 UTSW 2 127,380,258 (GRCm39) splice site probably benign
R0165:Prom2 UTSW 2 127,381,434 (GRCm39) splice site probably benign
R0220:Prom2 UTSW 2 127,383,027 (GRCm39) missense probably benign 0.03
R0466:Prom2 UTSW 2 127,370,709 (GRCm39) missense probably damaging 0.99
R0505:Prom2 UTSW 2 127,374,787 (GRCm39) missense possibly damaging 0.82
R0605:Prom2 UTSW 2 127,381,915 (GRCm39) critical splice donor site probably null
R0633:Prom2 UTSW 2 127,381,445 (GRCm39) missense probably benign 0.19
R0947:Prom2 UTSW 2 127,380,183 (GRCm39) missense possibly damaging 0.69
R1682:Prom2 UTSW 2 127,382,082 (GRCm39) missense possibly damaging 0.90
R1806:Prom2 UTSW 2 127,374,802 (GRCm39) missense probably damaging 1.00
R1859:Prom2 UTSW 2 127,383,017 (GRCm39) missense probably damaging 0.97
R1864:Prom2 UTSW 2 127,381,707 (GRCm39) missense probably benign 0.00
R1866:Prom2 UTSW 2 127,378,514 (GRCm39) missense probably damaging 0.99
R3824:Prom2 UTSW 2 127,377,593 (GRCm39) splice site probably benign
R4472:Prom2 UTSW 2 127,382,111 (GRCm39) missense probably benign 0.06
R5078:Prom2 UTSW 2 127,373,757 (GRCm39) missense probably benign 0.00
R5889:Prom2 UTSW 2 127,371,331 (GRCm39) missense possibly damaging 0.79
R5930:Prom2 UTSW 2 127,372,053 (GRCm39) nonsense probably null
R6214:Prom2 UTSW 2 127,381,695 (GRCm39) critical splice donor site probably null
R6215:Prom2 UTSW 2 127,381,695 (GRCm39) critical splice donor site probably null
R6914:Prom2 UTSW 2 127,372,295 (GRCm39) missense possibly damaging 0.78
R7099:Prom2 UTSW 2 127,381,698 (GRCm39) missense probably benign
R7427:Prom2 UTSW 2 127,381,731 (GRCm39) missense probably damaging 0.99
R7428:Prom2 UTSW 2 127,381,731 (GRCm39) missense probably damaging 0.99
R7525:Prom2 UTSW 2 127,374,701 (GRCm39) missense probably benign
R8477:Prom2 UTSW 2 127,381,124 (GRCm39) missense probably benign 0.01
R9287:Prom2 UTSW 2 127,380,185 (GRCm39) missense probably damaging 0.98
R9337:Prom2 UTSW 2 127,371,094 (GRCm39) missense probably damaging 0.99
Z1176:Prom2 UTSW 2 127,374,695 (GRCm39) missense probably damaging 1.00
Z1177:Prom2 UTSW 2 127,381,446 (GRCm39) missense probably benign 0.19
Z1177:Prom2 UTSW 2 127,380,225 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAGGAAGATTCAGGGCTGTTAC -3'
(R):5'- TCATATGTAGAGCATCCAGCTTGCG -3'

Sequencing Primer
(F):5'- tgggaggcagaggcagg -3'
(R):5'- CCTAGAGCAGAGCAAGCCTG -3'
Posted On 2013-04-11