Incidental Mutation 'R1807:Me1'
ID203542
Institutional Source Beutler Lab
Gene Symbol Me1
Ensembl Gene ENSMUSG00000032418
Gene Namemalic enzyme 1, NADP(+)-dependent, cytosolic
SynonymsMod-1, Mdh-1, Mod1, D9Ertd267e
MMRRC Submission 039836-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1807 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location86581371-86695953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86650879 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 197 (T197S)
Ref Sequence ENSEMBL: ENSMUSP00000034989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034989] [ENSMUST00000185374]
Predicted Effect probably damaging
Transcript: ENSMUST00000034989
AA Change: T197S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034989
Gene: ENSMUSG00000032418
AA Change: T197S

DomainStartEndE-ValueType
malic 79 260 7.34e-106 SMART
Malic_M 270 522 1.09e-111 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000185374
AA Change: T177S

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140887
Gene: ENSMUSG00000032418
AA Change: T177S

DomainStartEndE-ValueType
malic 59 240 7.34e-106 SMART
Malic_M 250 502 1.09e-111 SMART
Meta Mutation Damage Score 0.8716 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.7%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic, NADP-dependent enzyme that generates NADPH for fatty acid biosynthesis. The activity of this enzyme, the reversible oxidative decarboxylation of malate, links the glycolytic and citric acid cycles. The regulation of expression for this gene is complex. Increased expression can result from elevated levels of thyroid hormones or by higher proportions of carbohydrates in the diet. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit decreased body weight on a medium fat diet, altered cytoplasmic malic enzyme activity, and a male-specific reduction in food intake on a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C T 17: 35,895,069 W27* probably null Het
4933425L06Rik A T 13: 105,082,236 Q26L probably benign Het
4933430I17Rik T A 4: 62,542,756 Y289* probably null Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
A3galt2 A G 4: 128,767,601 I348V probably benign Het
Abca13 A G 11: 9,291,755 Y1206C probably damaging Het
Adar T C 3: 89,734,865 S18P probably benign Het
Akr1cl T C 1: 65,021,947 D139G possibly damaging Het
Aldh1b1 A G 4: 45,802,873 Y137C possibly damaging Het
Arsa T C 15: 89,475,322 M86V possibly damaging Het
Atg9b C A 5: 24,387,057 R648L probably damaging Het
Atrn A G 2: 130,982,772 N1042S possibly damaging Het
Ccdc130 C T 8: 84,260,307 R187Q probably damaging Het
Ccdc6 T A 10: 70,175,159 D325E possibly damaging Het
Cdk12 T C 11: 98,210,377 S354P unknown Het
Chst3 T A 10: 60,186,308 Y239F probably benign Het
Cilp2 C A 8: 69,882,194 R718L probably damaging Het
Col27a1 A G 4: 63,331,349 probably benign Het
Ctbp2 T C 7: 133,014,408 N266S probably benign Het
Ctnnd2 T C 15: 30,619,871 V123A probably damaging Het
D7Ertd443e T A 7: 134,293,305 E552V probably null Het
Dcst1 T A 3: 89,353,541 H516L probably damaging Het
Drd2 C T 9: 49,405,067 L376F probably damaging Het
Edn1 A G 13: 42,306,794 N175S probably damaging Het
Eipr1 G T 12: 28,766,839 G65V probably damaging Het
Epha4 G A 1: 77,374,904 P905S probably benign Het
Erbb2 T C 11: 98,428,854 Y591H probably damaging Het
Fam135b G A 15: 71,463,912 R478C probably benign Het
Fam49a G A 12: 12,361,504 R123Q probably benign Het
Fat2 T C 11: 55,289,259 T1419A probably damaging Het
Flnb C T 14: 7,934,645 T2239I probably benign Het
Gm7713 T C 15: 59,994,471 noncoding transcript Het
Gm9008 A G 6: 76,497,414 V73A probably benign Het
Hsf5 C T 11: 87,657,342 P617L probably benign Het
Kcnk12 C A 17: 87,746,040 R398L probably benign Het
Kif21b T A 1: 136,147,793 N219K possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra5 A T 6: 129,899,420 F141L probably benign Het
Lmtk3 C T 7: 45,793,278 P462S probably benign Het
Mast2 A G 4: 116,310,741 probably benign Het
Msr1 T A 8: 39,619,907 Q267L probably benign Het
Nfic T C 10: 81,404,985 T328A probably benign Het
Nphp3 G A 9: 104,020,741 D390N probably benign Het
Nr2e1 T A 10: 42,582,909 probably null Het
Olfr1094 T A 2: 86,829,101 F116L probably benign Het
Olfr603 T A 7: 103,383,583 N140Y probably benign Het
Pard6b T C 2: 168,087,412 L46P probably damaging Het
Prkaa1 T A 15: 5,143,954 L20Q probably damaging Het
Rapgefl1 T C 11: 98,845,989 probably null Het
Recql5 T C 11: 115,895,115 K611E possibly damaging Het
Rexo1 A T 10: 80,542,579 I1180N possibly damaging Het
Rph3a T C 5: 120,945,393 N605D probably damaging Het
Sema6a A G 18: 47,276,424 V592A possibly damaging Het
Skint11 A T 4: 114,194,696 R80S probably benign Het
Smpdl3a C A 10: 57,801,022 P72H probably damaging Het
Sobp T G 10: 43,160,826 M39L possibly damaging Het
Sparcl1 T A 5: 104,085,761 Y574F probably damaging Het
Spns3 C T 11: 72,538,340 W206* probably null Het
Srf A G 17: 46,553,759 V190A possibly damaging Het
Stag1 T G 9: 100,908,666 H742Q probably benign Het
Strn3 A T 12: 51,627,203 S542T probably benign Het
Synpo2 T C 3: 123,080,257 E1020G possibly damaging Het
Tcerg1l T A 7: 138,395,097 H137L probably benign Het
Tlr12 A T 4: 128,617,436 D340E probably benign Het
Tmem130 T A 5: 144,755,364 T77S probably benign Het
Tmem143 C A 7: 45,897,613 R68S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Trem1 G T 17: 48,241,635 G67* probably null Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Txndc9 A T 1: 37,994,015 H95Q probably damaging Het
Zfp35 T A 18: 24,003,929 N443K probably benign Het
Other mutations in Me1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Me1 APN 9 86598748 missense probably damaging 1.00
IGL01326:Me1 APN 9 86598718 critical splice donor site probably null
IGL02231:Me1 APN 9 86611855 missense possibly damaging 0.92
IGL02343:Me1 APN 9 86654641 critical splice donor site probably null
IGL02444:Me1 APN 9 86582914 splice site probably benign
IGL02655:Me1 APN 9 86654727 splice site probably benign
IGL03282:Me1 APN 9 86613596 missense probably damaging 0.99
R0116:Me1 UTSW 9 86654667 missense probably benign 0.01
R0270:Me1 UTSW 9 86596204 splice site probably benign
R0361:Me1 UTSW 9 86651002 missense probably damaging 1.00
R1535:Me1 UTSW 9 86587043 missense probably damaging 0.96
R1601:Me1 UTSW 9 86678012 missense probably damaging 1.00
R2085:Me1 UTSW 9 86613554 missense probably damaging 1.00
R2571:Me1 UTSW 9 86654698 missense probably damaging 1.00
R3012:Me1 UTSW 9 86611912 missense probably benign 0.00
R4649:Me1 UTSW 9 86679852 missense probably benign 0.00
R5540:Me1 UTSW 9 86679873 missense possibly damaging 0.60
R6129:Me1 UTSW 9 86650956 missense probably damaging 1.00
R6727:Me1 UTSW 9 86582798 missense possibly damaging 0.92
R7718:Me1 UTSW 9 86679900 missense probably damaging 1.00
R8329:Me1 UTSW 9 86619737 missense probably damaging 1.00
RF001:Me1 UTSW 9 86582823 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGGCGTCAATACTTATTCAAAG -3'
(R):5'- GACCAGTAATGAAGACGGCC -3'

Sequencing Primer
(F):5'- TTGAGACCACTAAGGAGGATGAATTC -3'
(R):5'- GACCAGTAATGAAGACGGCCTTTTTG -3'
Posted On2014-06-23