Incidental Mutation 'R1807:Recql5'
ID203558
Institutional Source Beutler Lab
Gene Symbol Recql5
Ensembl Gene ENSMUSG00000020752
Gene NameRecQ protein-like 5
SynonymsRecq5b, Recql5b
MMRRC Submission 039836-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.392) question?
Stock #R1807 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115892595-115933477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115895115 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 611 (K611E)
Ref Sequence ENSEMBL: ENSMUSP00000021097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021097] [ENSMUST00000093911] [ENSMUST00000131578] [ENSMUST00000140174] [ENSMUST00000152171] [ENSMUST00000167507] [ENSMUST00000222123]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021097
AA Change: K611E

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021097
Gene: ENSMUSG00000020752
AA Change: K611E

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
HELICc 274 355 8.68e-22 SMART
Pfam:RecQ_Zn_bind 366 436 1.8e-12 PFAM
low complexity region 472 499 N/A INTRINSIC
PDB:4BK0|B 516 621 2e-51 PDB
Pfam:RecQ5 626 818 3.1e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093911
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131578
SMART Domains Protein: ENSMUSP00000136178
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
HELICc 1 82 8.68e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136774
Predicted Effect probably benign
Transcript: ENSMUST00000140174
SMART Domains Protein: ENSMUSP00000136506
Gene: ENSMUSG00000020752

DomainStartEndE-ValueType
DEXDc 25 230 1.13e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147172
Predicted Effect probably benign
Transcript: ENSMUST00000152171
SMART Domains Protein: ENSMUSP00000139148
Gene: ENSMUSG00000048442

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000222123
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.7%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene express elevated levels of sister chromatid exchange due to a failure to suppress crossovers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C T 17: 35,895,069 W27* probably null Het
4933425L06Rik A T 13: 105,082,236 Q26L probably benign Het
4933430I17Rik T A 4: 62,542,756 Y289* probably null Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
A3galt2 A G 4: 128,767,601 I348V probably benign Het
Abca13 A G 11: 9,291,755 Y1206C probably damaging Het
Adar T C 3: 89,734,865 S18P probably benign Het
Akr1cl T C 1: 65,021,947 D139G possibly damaging Het
Aldh1b1 A G 4: 45,802,873 Y137C possibly damaging Het
Arsa T C 15: 89,475,322 M86V possibly damaging Het
Atg9b C A 5: 24,387,057 R648L probably damaging Het
Atrn A G 2: 130,982,772 N1042S possibly damaging Het
Ccdc130 C T 8: 84,260,307 R187Q probably damaging Het
Ccdc6 T A 10: 70,175,159 D325E possibly damaging Het
Cdk12 T C 11: 98,210,377 S354P unknown Het
Chst3 T A 10: 60,186,308 Y239F probably benign Het
Cilp2 C A 8: 69,882,194 R718L probably damaging Het
Col27a1 A G 4: 63,331,349 probably benign Het
Ctbp2 T C 7: 133,014,408 N266S probably benign Het
Ctnnd2 T C 15: 30,619,871 V123A probably damaging Het
D7Ertd443e T A 7: 134,293,305 E552V probably null Het
Dcst1 T A 3: 89,353,541 H516L probably damaging Het
Drd2 C T 9: 49,405,067 L376F probably damaging Het
Edn1 A G 13: 42,306,794 N175S probably damaging Het
Eipr1 G T 12: 28,766,839 G65V probably damaging Het
Epha4 G A 1: 77,374,904 P905S probably benign Het
Erbb2 T C 11: 98,428,854 Y591H probably damaging Het
Fam135b G A 15: 71,463,912 R478C probably benign Het
Fam49a G A 12: 12,361,504 R123Q probably benign Het
Fat2 T C 11: 55,289,259 T1419A probably damaging Het
Flnb C T 14: 7,934,645 T2239I probably benign Het
Gm7713 T C 15: 59,994,471 noncoding transcript Het
Gm9008 A G 6: 76,497,414 V73A probably benign Het
Hsf5 C T 11: 87,657,342 P617L probably benign Het
Kcnk12 C A 17: 87,746,040 R398L probably benign Het
Kif21b T A 1: 136,147,793 N219K possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra5 A T 6: 129,899,420 F141L probably benign Het
Lmtk3 C T 7: 45,793,278 P462S probably benign Het
Mast2 A G 4: 116,310,741 probably benign Het
Me1 T A 9: 86,650,879 T197S probably damaging Het
Msr1 T A 8: 39,619,907 Q267L probably benign Het
Nfic T C 10: 81,404,985 T328A probably benign Het
Nphp3 G A 9: 104,020,741 D390N probably benign Het
Nr2e1 T A 10: 42,582,909 probably null Het
Olfr1094 T A 2: 86,829,101 F116L probably benign Het
Olfr603 T A 7: 103,383,583 N140Y probably benign Het
Pard6b T C 2: 168,087,412 L46P probably damaging Het
Prkaa1 T A 15: 5,143,954 L20Q probably damaging Het
Rapgefl1 T C 11: 98,845,989 probably null Het
Rexo1 A T 10: 80,542,579 I1180N possibly damaging Het
Rph3a T C 5: 120,945,393 N605D probably damaging Het
Sema6a A G 18: 47,276,424 V592A possibly damaging Het
Skint11 A T 4: 114,194,696 R80S probably benign Het
Smpdl3a C A 10: 57,801,022 P72H probably damaging Het
Sobp T G 10: 43,160,826 M39L possibly damaging Het
Sparcl1 T A 5: 104,085,761 Y574F probably damaging Het
Spns3 C T 11: 72,538,340 W206* probably null Het
Srf A G 17: 46,553,759 V190A possibly damaging Het
Stag1 T G 9: 100,908,666 H742Q probably benign Het
Strn3 A T 12: 51,627,203 S542T probably benign Het
Synpo2 T C 3: 123,080,257 E1020G possibly damaging Het
Tcerg1l T A 7: 138,395,097 H137L probably benign Het
Tlr12 A T 4: 128,617,436 D340E probably benign Het
Tmem130 T A 5: 144,755,364 T77S probably benign Het
Tmem143 C A 7: 45,897,613 R68S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Trem1 G T 17: 48,241,635 G67* probably null Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Txndc9 A T 1: 37,994,015 H95Q probably damaging Het
Zfp35 T A 18: 24,003,929 N443K probably benign Het
Other mutations in Recql5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Recql5 APN 11 115897181 missense probably benign 0.04
IGL01589:Recql5 APN 11 115894669 missense probably damaging 1.00
IGL02040:Recql5 APN 11 115932797 missense possibly damaging 0.89
IGL02131:Recql5 APN 11 115923242 missense probably benign 0.01
IGL02198:Recql5 APN 11 115894673 missense probably benign 0.00
IGL02236:Recql5 APN 11 115894030 missense probably benign 0.01
IGL02501:Recql5 APN 11 115895091 missense probably benign 0.26
IGL02980:Recql5 APN 11 115893944 splice site probably null
IGL03028:Recql5 APN 11 115894431 missense possibly damaging 0.94
PIT4581001:Recql5 UTSW 11 115932856 missense possibly damaging 0.53
R0152:Recql5 UTSW 11 115894673 missense probably benign
R0269:Recql5 UTSW 11 115928224 missense possibly damaging 0.91
R0317:Recql5 UTSW 11 115894673 missense probably benign
R0511:Recql5 UTSW 11 115928383 missense probably benign 0.00
R0786:Recql5 UTSW 11 115895802 missense probably benign
R0975:Recql5 UTSW 11 115923256 missense probably damaging 1.00
R1170:Recql5 UTSW 11 115897234 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1208:Recql5 UTSW 11 115893156 missense probably damaging 0.98
R1872:Recql5 UTSW 11 115923309 missense probably benign 0.15
R1878:Recql5 UTSW 11 115895101 missense probably benign 0.00
R1935:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1936:Recql5 UTSW 11 115897191 missense probably benign 0.00
R1945:Recql5 UTSW 11 115928297 nonsense probably null
R2011:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2012:Recql5 UTSW 11 115897097 missense probably benign 0.20
R2023:Recql5 UTSW 11 115893640 missense probably benign
R2183:Recql5 UTSW 11 115896787 missense probably benign 0.00
R3881:Recql5 UTSW 11 115893954 missense probably benign
R3881:Recql5 UTSW 11 115893955 missense probably benign 0.00
R4093:Recql5 UTSW 11 115904888 missense probably benign 0.05
R4857:Recql5 UTSW 11 115928212 missense probably damaging 1.00
R5245:Recql5 UTSW 11 115893559 missense probably damaging 1.00
R5323:Recql5 UTSW 11 115927389 missense probably damaging 1.00
R5796:Recql5 UTSW 11 115927865 intron probably benign
R6160:Recql5 UTSW 11 115932787 critical splice donor site probably null
R6229:Recql5 UTSW 11 115930714 missense probably damaging 0.96
R6824:Recql5 UTSW 11 115923212 missense possibly damaging 0.83
R7013:Recql5 UTSW 11 115894576 missense probably benign 0.02
R7043:Recql5 UTSW 11 115930676 critical splice donor site probably null
R7135:Recql5 UTSW 11 115930672 splice site probably null
R7354:Recql5 UTSW 11 115928201 missense probably damaging 1.00
R7373:Recql5 UTSW 11 115928372 missense possibly damaging 0.92
R7503:Recql5 UTSW 11 115895055 missense probably benign 0.00
R7574:Recql5 UTSW 11 115928422 missense probably benign
R7597:Recql5 UTSW 11 115928381 missense probably benign 0.03
R7658:Recql5 UTSW 11 115923276 missense probably damaging 1.00
R8025:Recql5 UTSW 11 115928112 missense probably damaging 1.00
R8038:Recql5 UTSW 11 115927352 missense possibly damaging 0.90
R8316:Recql5 UTSW 11 115894035 missense possibly damaging 0.46
X0026:Recql5 UTSW 11 115923261 missense probably damaging 1.00
X0028:Recql5 UTSW 11 115894606 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTTCTGACATCTGGGAGAGG -3'
(R):5'- TGACACCAGTAAAGCTCATCTG -3'

Sequencing Primer
(F):5'- AGAAGTCTGTCCCACTAGAGG -3'
(R):5'- AAAGCTCATCTGCTGACTGG -3'
Posted On2014-06-23