Incidental Mutation 'R1808:Ccdc3'
ID203576
Institutional Source Beutler Lab
Gene Symbol Ccdc3
Ensembl Gene ENSMUSG00000026676
Gene Namecoiled-coil domain containing 3
Synonyms
MMRRC Submission 039837-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R1808 (G1)
Quality Score223
Status Not validated
Chromosome2
Chromosomal Location5137776-5230878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5138085 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 51 (L51Q)
Ref Sequence ENSEMBL: ENSMUSP00000027988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027988]
Predicted Effect probably damaging
Transcript: ENSMUST00000027988
AA Change: L51Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027988
Gene: ENSMUSG00000026676
AA Change: L51Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
coiled coil region 188 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180479
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Aging mice homozygous for a null allele are lean and show decreased epididymal and subcutaneous adipose tissue weight and adipocyte size, mild hyperglycemia, increased insulin sensitivity, reduced liver triglyceride levels and steatosis, and fewer inflammatory cells in epididymal fat tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik G T 5: 146,184,881 Y69* probably null Het
2310011J03Rik A G 10: 80,320,181 probably null Het
A2ml1 A C 6: 128,543,299 D1367E probably damaging Het
Adam6a C G 12: 113,544,714 L236V probably benign Het
Arf3 T C 15: 98,741,073 N101S probably benign Het
Arhgap42 T C 9: 9,180,050 E76G probably damaging Het
Atp2a1 A G 7: 126,453,401 F382S probably damaging Het
Bud13 T A 9: 46,288,407 F355L probably benign Het
C2 G A 17: 34,864,532 P349S probably damaging Het
Cbl C A 9: 44,164,229 G373V probably damaging Het
Ccdc34 T A 2: 110,044,256 M320K probably benign Het
Cntln A G 4: 85,096,763 E1097G probably damaging Het
Ctsc A C 7: 88,299,542 K195Q possibly damaging Het
Ctsf C T 19: 4,856,534 P163L probably benign Het
Dcxr A T 11: 120,725,612 probably null Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dnah8 T C 17: 30,684,186 L933P probably damaging Het
Dtna T C 18: 23,569,640 L76P probably damaging Het
Fcgbp T A 7: 28,085,090 C192S probably benign Het
Galnt5 T A 2: 58,026,125 D683E probably benign Het
Greb1l G A 18: 10,542,143 A1297T probably benign Het
Grik4 T C 9: 42,629,026 N286S probably benign Het
Hrc A T 7: 45,336,778 E451V probably damaging Het
Hrh3 G A 2: 180,099,784 probably benign Het
Ints13 A G 6: 146,554,197 I152T probably damaging Het
Irgm1 A T 11: 48,866,432 V184D probably damaging Het
Itga5 C T 15: 103,350,399 A791T probably damaging Het
Kcp T C 6: 29,505,655 T73A probably benign Het
Kidins220 A G 12: 25,003,009 T433A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2d T C 15: 98,866,686 D12G probably damaging Het
Mms19 A G 19: 41,966,259 S74P probably damaging Het
Myh1 G T 11: 67,211,474 E864* probably null Het
Nek1 A G 8: 61,016,230 D107G probably damaging Het
Npc1 T C 18: 12,194,092 N1149D probably damaging Het
Olfr127 T A 17: 37,903,770 S75T probably damaging Het
Olfr1280 T C 2: 111,315,998 V173A probably benign Het
Olfr401 C A 11: 74,121,431 S47R probably damaging Het
Olfr507 A C 7: 108,622,610 K266T possibly damaging Het
Osbp T C 19: 11,970,778 S150P probably damaging Het
Paf1 T C 7: 28,396,822 Y287H probably damaging Het
Pdgfrb T C 18: 61,068,102 V420A probably benign Het
Pdss1 G T 2: 22,906,834 E120* probably null Het
Pink1 A T 4: 138,317,319 V339E probably damaging Het
Pkn3 C T 2: 30,079,651 R58C probably damaging Het
Pm20d1 G A 1: 131,802,427 V235I probably benign Het
Ppp2r2a A G 14: 67,038,963 I31T probably damaging Het
Rbms3 T C 9: 116,822,826 E152G probably damaging Het
Rfx1 A C 8: 84,095,048 Q804H probably damaging Het
Rpe G T 1: 66,715,197 V143L probably benign Het
Sap30l G T 11: 57,809,945 V142L probably benign Het
Sh3tc1 T C 5: 35,705,924 Q973R probably benign Het
Slc10a2 T C 8: 5,104,856 T110A probably damaging Het
Snrnp200 A T 2: 127,219,027 probably null Het
Snrnp200 G A 2: 127,219,028 probably null Het
Spaca3 T A 11: 80,867,685 V158E probably damaging Het
Sprtn C A 8: 124,903,031 N354K probably benign Het
Stab1 T A 14: 31,141,144 Y2166F possibly damaging Het
Tmem106c G A 15: 97,968,667 probably null Het
Tnc A G 4: 63,999,931 S1248P probably damaging Het
Tshr T C 12: 91,537,316 F343L probably benign Het
Ttn C A 2: 76,725,354 A30436S probably damaging Het
Ubxn2a A T 12: 4,885,839 M68K probably benign Het
Ucp2 T C 7: 100,498,814 V238A probably damaging Het
Urgcp C A 11: 5,717,242 L365F probably damaging Het
Vezt A T 10: 93,990,164 D328E probably damaging Het
Vmn1r168 G T 7: 23,540,759 V14L probably benign Het
Vps13b T C 15: 35,792,059 F2158L probably benign Het
Other mutations in Ccdc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Ccdc3 UTSW 2 5138205 missense probably damaging 1.00
R1164:Ccdc3 UTSW 2 5141266 missense possibly damaging 0.95
R3832:Ccdc3 UTSW 2 5229142 missense probably benign 0.18
R5686:Ccdc3 UTSW 2 5138060 missense probably damaging 1.00
R5878:Ccdc3 UTSW 2 5229016 missense probably benign 0.27
R6003:Ccdc3 UTSW 2 5141407 critical splice donor site probably null
R6053:Ccdc3 UTSW 2 5229027 missense probably benign 0.22
R6987:Ccdc3 UTSW 2 5138304 missense possibly damaging 0.76
R7470:Ccdc3 UTSW 2 5138304 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ATCTCCTCTAGTCACCCTGGAG -3'
(R):5'- AGTAGCCCAGACCAGTAAGG -3'

Sequencing Primer
(F):5'- ACCCTTTTTAAGCGTGGCG -3'
(R):5'- CCAGTAAGGTTGAGCCGG -3'
Posted On2014-06-23