Incidental Mutation 'R1808:Fcgbp'
ID203597
Institutional Source Beutler Lab
Gene Symbol Fcgbp
Ensembl Gene ENSMUSG00000047730
Gene NameFc fragment of IgG binding protein
SynonymsA430096B05Rik
MMRRC Submission 039837-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1808 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location28071236-28120862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28085090 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 192 (C192S)
Ref Sequence ENSEMBL: ENSMUSP00000075945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076648] [ENSMUST00000138392]
Predicted Effect probably benign
Transcript: ENSMUST00000076648
AA Change: C192S

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000075945
Gene: ENSMUSG00000047730
AA Change: C192S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 1.2e-12 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 6.85e-35 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 4.7e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.7e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 5e-12 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138392
AA Change: C192S

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114271
Gene: ENSMUSG00000047730
AA Change: C192S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
FOLN 27 49 2.3e-4 SMART
VWD 46 211 5.26e-45 SMART
low complexity region 226 237 N/A INTRINSIC
C8 251 326 1.17e-34 SMART
Pfam:TIL 329 383 8.4e-13 PFAM
VWC 385 431 2.34e-1 SMART
FOLN 418 441 3.48e1 SMART
VWD 438 603 7.99e-36 SMART
C8 642 717 1.4e-32 SMART
Pfam:TIL 720 773 3.3e-14 PFAM
VWC 775 829 9.42e-1 SMART
VWD 824 990 7.86e-44 SMART
C8 1034 1109 1.66e-34 SMART
Pfam:TIL 1112 1165 6.9e-13 PFAM
VWC 1167 1225 9.8e-3 SMART
FOLN 1198 1220 9.55e-1 SMART
FOLN 1224 1246 2.41e0 SMART
VWD 1243 1411 6.59e-37 SMART
C8 1451 1527 5.6e-32 SMART
low complexity region 1541 1551 N/A INTRINSIC
EGF_like 1558 1581 6.15e1 SMART
VWC 1589 1682 1.6e-2 SMART
VWD 1640 1807 5.15e-39 SMART
C8 1839 1914 4.62e-33 SMART
EGF_like 1942 1965 4.46e1 SMART
VWC 1972 2064 1.92e-1 SMART
VWD 2024 2180 6.34e-39 SMART
low complexity region 2201 2214 N/A INTRINSIC
C8 2221 2296 3.7e-32 SMART
Pfam:TIL 2299 2352 1e-11 PFAM
VWC 2354 2413 8.29e-1 SMART
FOLN 2385 2407 4.96e1 SMART
VWD 2404 2566 1.89e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140004
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik G T 5: 146,184,881 Y69* probably null Het
2310011J03Rik A G 10: 80,320,181 probably null Het
A2ml1 A C 6: 128,543,299 D1367E probably damaging Het
Adam6a C G 12: 113,544,714 L236V probably benign Het
Arf3 T C 15: 98,741,073 N101S probably benign Het
Arhgap42 T C 9: 9,180,050 E76G probably damaging Het
Atp2a1 A G 7: 126,453,401 F382S probably damaging Het
Bud13 T A 9: 46,288,407 F355L probably benign Het
C2 G A 17: 34,864,532 P349S probably damaging Het
Cbl C A 9: 44,164,229 G373V probably damaging Het
Ccdc3 T A 2: 5,138,085 L51Q probably damaging Het
Ccdc34 T A 2: 110,044,256 M320K probably benign Het
Cntln A G 4: 85,096,763 E1097G probably damaging Het
Ctsc A C 7: 88,299,542 K195Q possibly damaging Het
Ctsf C T 19: 4,856,534 P163L probably benign Het
Dcxr A T 11: 120,725,612 probably null Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dnah8 T C 17: 30,684,186 L933P probably damaging Het
Dtna T C 18: 23,569,640 L76P probably damaging Het
Galnt5 T A 2: 58,026,125 D683E probably benign Het
Greb1l G A 18: 10,542,143 A1297T probably benign Het
Grik4 T C 9: 42,629,026 N286S probably benign Het
Hrc A T 7: 45,336,778 E451V probably damaging Het
Hrh3 G A 2: 180,099,784 probably benign Het
Ints13 A G 6: 146,554,197 I152T probably damaging Het
Irgm1 A T 11: 48,866,432 V184D probably damaging Het
Itga5 C T 15: 103,350,399 A791T probably damaging Het
Kcp T C 6: 29,505,655 T73A probably benign Het
Kidins220 A G 12: 25,003,009 T433A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2d T C 15: 98,866,686 D12G probably damaging Het
Mms19 A G 19: 41,966,259 S74P probably damaging Het
Myh1 G T 11: 67,211,474 E864* probably null Het
Nek1 A G 8: 61,016,230 D107G probably damaging Het
Npc1 T C 18: 12,194,092 N1149D probably damaging Het
Olfr127 T A 17: 37,903,770 S75T probably damaging Het
Olfr1280 T C 2: 111,315,998 V173A probably benign Het
Olfr401 C A 11: 74,121,431 S47R probably damaging Het
Olfr507 A C 7: 108,622,610 K266T possibly damaging Het
Osbp T C 19: 11,970,778 S150P probably damaging Het
Paf1 T C 7: 28,396,822 Y287H probably damaging Het
Pdgfrb T C 18: 61,068,102 V420A probably benign Het
Pdss1 G T 2: 22,906,834 E120* probably null Het
Pink1 A T 4: 138,317,319 V339E probably damaging Het
Pkn3 C T 2: 30,079,651 R58C probably damaging Het
Pm20d1 G A 1: 131,802,427 V235I probably benign Het
Ppp2r2a A G 14: 67,038,963 I31T probably damaging Het
Rbms3 T C 9: 116,822,826 E152G probably damaging Het
Rfx1 A C 8: 84,095,048 Q804H probably damaging Het
Rpe G T 1: 66,715,197 V143L probably benign Het
Sap30l G T 11: 57,809,945 V142L probably benign Het
Sh3tc1 T C 5: 35,705,924 Q973R probably benign Het
Slc10a2 T C 8: 5,104,856 T110A probably damaging Het
Snrnp200 A T 2: 127,219,027 probably null Het
Snrnp200 G A 2: 127,219,028 probably null Het
Spaca3 T A 11: 80,867,685 V158E probably damaging Het
Sprtn C A 8: 124,903,031 N354K probably benign Het
Stab1 T A 14: 31,141,144 Y2166F possibly damaging Het
Tmem106c G A 15: 97,968,667 probably null Het
Tnc A G 4: 63,999,931 S1248P probably damaging Het
Tshr T C 12: 91,537,316 F343L probably benign Het
Ttn C A 2: 76,725,354 A30436S probably damaging Het
Ubxn2a A T 12: 4,885,839 M68K probably benign Het
Ucp2 T C 7: 100,498,814 V238A probably damaging Het
Urgcp C A 11: 5,717,242 L365F probably damaging Het
Vezt A T 10: 93,990,164 D328E probably damaging Het
Vmn1r168 G T 7: 23,540,759 V14L probably benign Het
Vps13b T C 15: 35,792,059 F2158L probably benign Het
Other mutations in Fcgbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Fcgbp APN 7 28085130 missense probably damaging 1.00
IGL00331:Fcgbp APN 7 28101541 splice site probably benign
IGL00335:Fcgbp APN 7 28086135 missense possibly damaging 0.90
IGL00470:Fcgbp APN 7 28075086 nonsense probably null
IGL00491:Fcgbp APN 7 28093402 missense probably damaging 1.00
IGL00498:Fcgbp APN 7 28091797 missense probably damaging 1.00
IGL01296:Fcgbp APN 7 28089647 missense probably benign 0.15
IGL01582:Fcgbp APN 7 28093642 missense probably benign 0.19
IGL01929:Fcgbp APN 7 28103963 missense probably damaging 1.00
IGL02024:Fcgbp APN 7 28106374 missense probably damaging 1.00
IGL02027:Fcgbp APN 7 28075204 missense probably damaging 1.00
IGL02140:Fcgbp APN 7 28091954 missense probably damaging 1.00
IGL02162:Fcgbp APN 7 28075235 missense probably damaging 1.00
IGL02345:Fcgbp APN 7 28071643 splice site probably benign
IGL02377:Fcgbp APN 7 28106970 missense possibly damaging 0.67
IGL02389:Fcgbp APN 7 28075171 missense probably damaging 1.00
IGL02423:Fcgbp APN 7 28089953 missense probably benign 0.02
IGL02523:Fcgbp APN 7 28104732 missense possibly damaging 0.89
IGL02561:Fcgbp APN 7 28101174 intron probably benign
IGL02631:Fcgbp APN 7 28085298 missense probably damaging 1.00
IGL02716:Fcgbp APN 7 28101434 missense probably damaging 0.98
IGL02836:Fcgbp APN 7 28117358 missense possibly damaging 0.91
IGL02957:Fcgbp APN 7 28091847 nonsense probably null
IGL02971:Fcgbp APN 7 28101473 missense probably damaging 1.00
IGL03284:Fcgbp APN 7 28085432 missense possibly damaging 0.93
IGL03379:Fcgbp APN 7 28089917 missense possibly damaging 0.76
IGL02796:Fcgbp UTSW 7 28101151 intron probably benign
PIT4486001:Fcgbp UTSW 7 28075273 missense possibly damaging 0.52
R0277:Fcgbp UTSW 7 28085493 critical splice donor site probably null
R0387:Fcgbp UTSW 7 28091454 splice site probably benign
R0586:Fcgbp UTSW 7 28089713 missense probably damaging 1.00
R0981:Fcgbp UTSW 7 28085110 nonsense probably null
R0987:Fcgbp UTSW 7 28094174 missense probably damaging 1.00
R1240:Fcgbp UTSW 7 28120525 missense probably damaging 1.00
R1394:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1395:Fcgbp UTSW 7 28093379 missense probably damaging 0.98
R1438:Fcgbp UTSW 7 28103733 nonsense probably null
R1474:Fcgbp UTSW 7 28091848 missense probably benign 0.00
R1521:Fcgbp UTSW 7 28075160 missense probably benign 0.00
R1740:Fcgbp UTSW 7 28101249 missense possibly damaging 0.87
R1750:Fcgbp UTSW 7 28093443 nonsense probably null
R1772:Fcgbp UTSW 7 28105175 missense possibly damaging 0.90
R1804:Fcgbp UTSW 7 28086139 missense probably benign
R1819:Fcgbp UTSW 7 28085283 missense probably benign 0.00
R1934:Fcgbp UTSW 7 28107093 missense probably damaging 1.00
R1972:Fcgbp UTSW 7 28094192 missense probably benign 0.11
R2051:Fcgbp UTSW 7 28120360 missense probably damaging 0.97
R2072:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2074:Fcgbp UTSW 7 28120389 missense probably damaging 0.98
R2124:Fcgbp UTSW 7 28092019 missense probably benign 0.03
R2155:Fcgbp UTSW 7 28107203 missense probably benign 0.00
R3015:Fcgbp UTSW 7 28075413 splice site probably benign
R3037:Fcgbp UTSW 7 28102702 missense possibly damaging 0.62
R3151:Fcgbp UTSW 7 28117240 missense probably damaging 1.00
R3176:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3177:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3276:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3277:Fcgbp UTSW 7 28091661 missense probably damaging 0.99
R3623:Fcgbp UTSW 7 28101276 missense probably damaging 1.00
R3730:Fcgbp UTSW 7 28085457 missense possibly damaging 0.82
R3935:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R3936:Fcgbp UTSW 7 28075399 missense probably benign 0.00
R4041:Fcgbp UTSW 7 28113979 missense probably benign 0.01
R4056:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4057:Fcgbp UTSW 7 28104116 missense probably benign 0.09
R4705:Fcgbp UTSW 7 28107296 missense probably benign 0.44
R4708:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4710:Fcgbp UTSW 7 28094961 missense probably benign 0.00
R4779:Fcgbp UTSW 7 28094937 missense probably damaging 1.00
R4820:Fcgbp UTSW 7 28113958 missense probably damaging 1.00
R4863:Fcgbp UTSW 7 28086344 missense probably benign 0.33
R4926:Fcgbp UTSW 7 28086235 missense probably damaging 0.99
R4947:Fcgbp UTSW 7 28089812 missense probably benign 0.00
R4979:Fcgbp UTSW 7 28117570 missense probably benign 0.06
R5002:Fcgbp UTSW 7 28086103 splice site probably null
R5219:Fcgbp UTSW 7 28104085 missense probably damaging 1.00
R5241:Fcgbp UTSW 7 28085199 missense probably damaging 1.00
R5301:Fcgbp UTSW 7 28093674 missense possibly damaging 0.93
R5306:Fcgbp UTSW 7 28091818 missense probably damaging 1.00
R5335:Fcgbp UTSW 7 28089734 missense probably damaging 1.00
R5399:Fcgbp UTSW 7 28105055 missense probably benign 0.05
R5418:Fcgbp UTSW 7 28085313 missense probably damaging 1.00
R5527:Fcgbp UTSW 7 28093635 missense probably benign
R5583:Fcgbp UTSW 7 28091579 missense probably damaging 1.00
R5698:Fcgbp UTSW 7 28092022 missense possibly damaging 0.95
R5780:Fcgbp UTSW 7 28085218 missense probably benign 0.02
R5813:Fcgbp UTSW 7 28101494 missense possibly damaging 0.64
R5910:Fcgbp UTSW 7 28085503 splice site probably benign
R5936:Fcgbp UTSW 7 28086692 missense probably damaging 0.98
R5992:Fcgbp UTSW 7 28120534 missense probably benign 0.05
R6091:Fcgbp UTSW 7 28104965 missense possibly damaging 0.90
R6372:Fcgbp UTSW 7 28107008 missense probably damaging 1.00
R6488:Fcgbp UTSW 7 28093538 missense probably damaging 0.96
R6548:Fcgbp UTSW 7 28091918 missense probably benign 0.00
R6553:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6585:Fcgbp UTSW 7 28113979 missense possibly damaging 0.79
R6695:Fcgbp UTSW 7 28086270 nonsense probably null
R6711:Fcgbp UTSW 7 28089673 missense probably damaging 0.99
R6803:Fcgbp UTSW 7 28103212 missense probably benign 0.00
R6822:Fcgbp UTSW 7 28107356 missense probably damaging 1.00
R6907:Fcgbp UTSW 7 28085018 missense probably damaging 1.00
R6912:Fcgbp UTSW 7 28089704 missense probably benign 0.15
R6924:Fcgbp UTSW 7 28093823 missense probably benign
R6943:Fcgbp UTSW 7 28092052 missense probably benign 0.22
R7060:Fcgbp UTSW 7 28091933 missense probably benign 0.20
R7103:Fcgbp UTSW 7 28084962 missense probably benign 0.00
R7208:Fcgbp UTSW 7 28104021 missense probably benign 0.01
R7291:Fcgbp UTSW 7 28101392 missense probably benign 0.00
R7301:Fcgbp UTSW 7 28093436 missense possibly damaging 0.65
R7404:Fcgbp UTSW 7 28101507 missense probably damaging 1.00
R7426:Fcgbp UTSW 7 28086524 missense probably benign 0.00
R7459:Fcgbp UTSW 7 28107285 missense possibly damaging 0.65
R7475:Fcgbp UTSW 7 28102976 missense probably damaging 0.99
R7505:Fcgbp UTSW 7 28089674 missense probably damaging 0.97
R7517:Fcgbp UTSW 7 28085369 missense probably damaging 1.00
R7519:Fcgbp UTSW 7 28086299 missense probably damaging 1.00
R7524:Fcgbp UTSW 7 28102966 missense probably damaging 1.00
R7649:Fcgbp UTSW 7 28091503 missense possibly damaging 0.88
R7782:Fcgbp UTSW 7 28085035 nonsense probably null
R7820:Fcgbp UTSW 7 28120359 missense probably benign 0.01
R7831:Fcgbp UTSW 7 28106979 missense probably damaging 0.98
R7835:Fcgbp UTSW 7 28117207 missense possibly damaging 0.64
R7914:Fcgbp UTSW 7 28106979 missense probably damaging 0.98
R7918:Fcgbp UTSW 7 28117207 missense possibly damaging 0.64
R8086:Fcgbp UTSW 7 28113964 missense probably damaging 1.00
R8137:Fcgbp UTSW 7 28105071 missense probably damaging 1.00
R8154:Fcgbp UTSW 7 28085082 missense probably benign 0.00
RF002:Fcgbp UTSW 7 28089755 missense probably benign
X0028:Fcgbp UTSW 7 28104020 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- CTCTCTGCAGATCGACAATCAG -3'
(R):5'- TGTGGACAGAGTTAGCATGC -3'

Sequencing Primer
(F):5'- GCAGATCGACAATCAGCGCTC -3'
(R):5'- ACAGAGACGGTCTCCCTTGTAG -3'
Posted On2014-06-23