Incidental Mutation 'R0110:Cntln'
ID 20360
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms B430108F07Rik, D530005L17Rik
MMRRC Submission 038396-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock # R0110 (G1)
Quality Score 175
Status Validated (trace)
Chromosome 4
Chromosomal Location 84884309-85131921 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 85096757 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 1095 (T1095I)
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000107190] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably damaging
Transcript: ENSMUST00000047023
AA Change: T1096I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: T1096I

low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107190
SMART Domains Protein: ENSMUSP00000102808
Gene: ENSMUSG00000038070

low complexity region 71 82 N/A INTRINSIC
Blast:HisKA 135 191 8e-27 BLAST
low complexity region 192 213 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169371
AA Change: T1095I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: T1095I

low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Meta Mutation Damage Score 0.1086 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency 98% (105/107)
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,506 probably benign Het
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arpc1b T A 5: 145,127,715 W361R probably damaging Het
Baiap2l1 T C 5: 144,275,891 Y438C probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dnah12 A G 14: 26,798,899 R1892G probably damaging Het
Dock4 A G 12: 40,621,312 probably benign Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Fam227b T A 2: 126,100,921 S319C probably damaging Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Gal3st2c C T 1: 94,009,497 P388L probably benign Het
Ggn C T 7: 29,171,296 P47S probably damaging Het
Gli3 T G 13: 15,724,785 L919R probably damaging Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 C A 1: 44,059,224 V905F probably benign Het
Gmip C T 8: 69,815,609 probably benign Het
Gpr39 C T 1: 125,677,500 T55M probably damaging Het
Grk4 A G 5: 34,716,213 T208A probably damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hadhb T C 5: 30,169,485 probably benign Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpa A T 2: 130,679,418 probably benign Het
Klhl10 A G 11: 100,456,932 T605A probably benign Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lap3 T C 5: 45,495,290 probably benign Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map3k6 T C 4: 133,243,794 L273P probably damaging Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mrc1 T A 2: 14,238,542 probably benign Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtcl1 C T 17: 66,358,114 E1149K possibly damaging Het
Naca C T 10: 128,044,790 A1897V probably benign Het
Ncapg T C 5: 45,693,147 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pla2g4a T A 1: 149,840,647 M688L possibly damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Prmt1 A G 7: 44,978,801 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Prom2 T G 2: 127,531,113 S679R possibly damaging Het
Psen2 T C 1: 180,238,914 T153A probably damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Stam2 A T 2: 52,719,986 probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Tas2r123 T C 6: 132,847,332 V64A probably benign Het
Tnnc1 A G 14: 31,211,408 D149G probably damaging Het
Tpp2 A G 1: 43,999,693 D1133G probably damaging Het
Tpp2 T A 1: 43,978,504 V756E probably benign Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Tsen15 A G 1: 152,371,797 V148A probably damaging Het
Ttn T A 2: 76,864,328 probably benign Het
Ube2u A G 4: 100,486,673 I90V probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Wdr41 T C 13: 95,018,111 probably benign Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp423 A G 8: 87,782,259 S486P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 85006434 missense probably benign 0.25
IGL00743:Cntln APN 4 84979415 missense probably benign 0.06
IGL01014:Cntln APN 4 85049908 missense probably benign 0.25
IGL02217:Cntln APN 4 85100258 missense probably damaging 1.00
IGL02323:Cntln APN 4 85049789 missense probably benign 0.00
IGL02353:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02360:Cntln APN 4 85049850 missense probably damaging 0.98
IGL02616:Cntln APN 4 85115452 critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84974000 missense probably damaging 0.99
R0324:Cntln UTSW 4 85092695 missense probably damaging 0.98
R0349:Cntln UTSW 4 84996485 missense probably damaging 1.00
R0519:Cntln UTSW 4 85005053 splice site probably benign
R0529:Cntln UTSW 4 85067825 missense probably damaging 1.00
R0582:Cntln UTSW 4 84884741 missense probably damaging 1.00
R1077:Cntln UTSW 4 84996479 missense probably damaging 1.00
R1345:Cntln UTSW 4 84973991 missense probably damaging 1.00
R1457:Cntln UTSW 4 85096839 missense probably benign 0.33
R1571:Cntln UTSW 4 84947586 nonsense probably null
R1622:Cntln UTSW 4 85063181 missense probably damaging 1.00
R1681:Cntln UTSW 4 84947635 missense probably damaging 1.00
R1777:Cntln UTSW 4 85130679 missense probably benign 0.23
R1808:Cntln UTSW 4 85096763 missense probably damaging 1.00
R1882:Cntln UTSW 4 85100835 missense probably damaging 1.00
R2056:Cntln UTSW 4 85049674 missense probably benign
R2965:Cntln UTSW 4 84974027 critical splice donor site probably null
R2968:Cntln UTSW 4 84957267 missense probably benign 0.27
R3104:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3106:Cntln UTSW 4 84957169 missense possibly damaging 0.95
R3121:Cntln UTSW 4 85005052 splice site probably benign
R3617:Cntln UTSW 4 85004977 nonsense probably null
R4009:Cntln UTSW 4 85063215 missense probably benign 0.45
R4036:Cntln UTSW 4 85006488 missense probably damaging 1.00
R4548:Cntln UTSW 4 85096842 missense probably benign 0.27
R4592:Cntln UTSW 4 84971182 missense probably benign 0.00
R4666:Cntln UTSW 4 84971216 missense probably benign 0.13
R4826:Cntln UTSW 4 85005044 missense probably benign 0.03
R4836:Cntln UTSW 4 85049720 nonsense probably null
R4856:Cntln UTSW 4 84971229 missense probably benign 0.35
R4886:Cntln UTSW 4 84971229 missense probably benign 0.35
R4995:Cntln UTSW 4 85049883 missense probably benign 0.00
R5090:Cntln UTSW 4 84947593 missense probably damaging 0.98
R5202:Cntln UTSW 4 84971229 missense probably benign 0.35
R5905:Cntln UTSW 4 84971173 missense probably benign 0.03
R5953:Cntln UTSW 4 85049919 missense possibly damaging 0.92
R6028:Cntln UTSW 4 84971173 missense probably benign 0.03
R6298:Cntln UTSW 4 85096761 missense probably damaging 1.00
R6351:Cntln UTSW 4 85115354 missense probably damaging 0.99
R6371:Cntln UTSW 4 84884579 missense probably damaging 0.98
R6481:Cntln UTSW 4 85067510 missense probably benign 0.00
R6864:Cntln UTSW 4 85096792 missense probably damaging 0.99
R6874:Cntln UTSW 4 85067759 missense probably damaging 1.00
R6919:Cntln UTSW 4 85115368 missense probably benign 0.04
R7071:Cntln UTSW 4 85100385 missense probably damaging 1.00
R7113:Cntln UTSW 4 85049827 missense probably damaging 0.98
R7152:Cntln UTSW 4 84884700 missense possibly damaging 0.87
R7253:Cntln UTSW 4 85118473 missense probably damaging 1.00
R7289:Cntln UTSW 4 85046303 missense possibly damaging 0.80
R7440:Cntln UTSW 4 85063216 missense possibly damaging 0.95
R7670:Cntln UTSW 4 84979340 missense possibly damaging 0.66
R7707:Cntln UTSW 4 84884616 missense probably damaging 1.00
R7895:Cntln UTSW 4 85063324 missense possibly damaging 0.91
R8176:Cntln UTSW 4 84888689 missense probably damaging 0.99
R8247:Cntln UTSW 4 85100780 missense probably benign 0.39
R8264:Cntln UTSW 4 85098411 missense probably damaging 1.00
R8293:Cntln UTSW 4 85033838 missense probably damaging 1.00
R8536:Cntln UTSW 4 84957049 missense probably damaging 1.00
R8844:Cntln UTSW 4 84973997 missense probably damaging 1.00
R8924:Cntln UTSW 4 84888699 missense probably damaging 1.00
R8955:Cntln UTSW 4 85067873 missense possibly damaging 0.85
R8960:Cntln UTSW 4 85100724 missense possibly damaging 0.59
R8979:Cntln UTSW 4 85130673 missense probably damaging 1.00
R9255:Cntln UTSW 4 85100866 missense possibly damaging 0.93
R9314:Cntln UTSW 4 85006482 missense probably damaging 1.00
R9353:Cntln UTSW 4 84884360 unclassified probably benign
R9361:Cntln UTSW 4 85049914 missense probably benign 0.23
R9376:Cntln UTSW 4 84957021 missense probably benign 0.24
R9382:Cntln UTSW 4 85050081 missense probably benign 0.13
R9471:Cntln UTSW 4 85049782 missense possibly damaging 0.62
R9478:Cntln UTSW 4 84979393 missense probably benign 0.00
R9527:Cntln UTSW 4 84973883 missense probably damaging 1.00
R9788:Cntln UTSW 4 85049856 missense probably damaging 1.00
R9793:Cntln UTSW 4 85067561 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgaaagcaaagcacagatgg -3'
Posted On 2013-04-11