Incidental Mutation 'R1808:Atp2a1'
ID203604
Institutional Source Beutler Lab
Gene Symbol Atp2a1
Ensembl Gene ENSMUSG00000030730
Gene NameATPase, Ca++ transporting, cardiac muscle, fast twitch 1
SynonymsSERCA1
MMRRC Submission 039837-MU
Accession Numbers

Genbank: NM_007504.2; Ensembl: ENSMUST00000032974

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1808 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126445858-126463108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126453401 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 382 (F382S)
Ref Sequence ENSEMBL: ENSMUSP00000032974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032974]
Predicted Effect probably damaging
Transcript: ENSMUST00000032974
AA Change: F382S

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000032974
Gene: ENSMUSG00000030730
AA Change: F382S

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.39e-16 SMART
Pfam:E1-E2_ATPase 92 340 1.5e-66 PFAM
Pfam:Hydrolase 345 715 7.5e-20 PFAM
Pfam:HAD 348 712 1.2e-18 PFAM
Pfam:Cation_ATPase 418 528 3.2e-23 PFAM
Pfam:Hydrolase_3 683 747 2.3e-7 PFAM
Pfam:Cation_ATPase_C 784 987 4.8e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133300
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in muscular excitation and contraction. Mutations in this gene cause some autosomal recessive forms of Brody disease, characterized by increasing impairment of muscular relaxation during exercise. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant neonates display respiratory distress, progressive cyanosis, and die within 30 minutes-2 hours after birth. Lung tissues and the diaphragm muscle show aberrant morphology. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik G T 5: 146,184,881 Y69* probably null Het
2310011J03Rik A G 10: 80,320,181 probably null Het
A2ml1 A C 6: 128,543,299 D1367E probably damaging Het
Adam6a C G 12: 113,544,714 L236V probably benign Het
Arf3 T C 15: 98,741,073 N101S probably benign Het
Arhgap42 T C 9: 9,180,050 E76G probably damaging Het
Bud13 T A 9: 46,288,407 F355L probably benign Het
C2 G A 17: 34,864,532 P349S probably damaging Het
Cbl C A 9: 44,164,229 G373V probably damaging Het
Ccdc3 T A 2: 5,138,085 L51Q probably damaging Het
Ccdc34 T A 2: 110,044,256 M320K probably benign Het
Cntln A G 4: 85,096,763 E1097G probably damaging Het
Ctsc A C 7: 88,299,542 K195Q possibly damaging Het
Ctsf C T 19: 4,856,534 P163L probably benign Het
Dcxr A T 11: 120,725,612 probably null Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dnah8 T C 17: 30,684,186 L933P probably damaging Het
Dtna T C 18: 23,569,640 L76P probably damaging Het
Fcgbp T A 7: 28,085,090 C192S probably benign Het
Galnt5 T A 2: 58,026,125 D683E probably benign Het
Greb1l G A 18: 10,542,143 A1297T probably benign Het
Grik4 T C 9: 42,629,026 N286S probably benign Het
Hrc A T 7: 45,336,778 E451V probably damaging Het
Hrh3 G A 2: 180,099,784 probably benign Het
Ints13 A G 6: 146,554,197 I152T probably damaging Het
Irgm1 A T 11: 48,866,432 V184D probably damaging Het
Itga5 C T 15: 103,350,399 A791T probably damaging Het
Kcp T C 6: 29,505,655 T73A probably benign Het
Kidins220 A G 12: 25,003,009 T433A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2d T C 15: 98,866,686 D12G probably damaging Het
Mms19 A G 19: 41,966,259 S74P probably damaging Het
Myh1 G T 11: 67,211,474 E864* probably null Het
Nek1 A G 8: 61,016,230 D107G probably damaging Het
Npc1 T C 18: 12,194,092 N1149D probably damaging Het
Olfr127 T A 17: 37,903,770 S75T probably damaging Het
Olfr1280 T C 2: 111,315,998 V173A probably benign Het
Olfr401 C A 11: 74,121,431 S47R probably damaging Het
Olfr507 A C 7: 108,622,610 K266T possibly damaging Het
Osbp T C 19: 11,970,778 S150P probably damaging Het
Paf1 T C 7: 28,396,822 Y287H probably damaging Het
Pdgfrb T C 18: 61,068,102 V420A probably benign Het
Pdss1 G T 2: 22,906,834 E120* probably null Het
Pink1 A T 4: 138,317,319 V339E probably damaging Het
Pkn3 C T 2: 30,079,651 R58C probably damaging Het
Pm20d1 G A 1: 131,802,427 V235I probably benign Het
Ppp2r2a A G 14: 67,038,963 I31T probably damaging Het
Rbms3 T C 9: 116,822,826 E152G probably damaging Het
Rfx1 A C 8: 84,095,048 Q804H probably damaging Het
Rpe G T 1: 66,715,197 V143L probably benign Het
Sap30l G T 11: 57,809,945 V142L probably benign Het
Sh3tc1 T C 5: 35,705,924 Q973R probably benign Het
Slc10a2 T C 8: 5,104,856 T110A probably damaging Het
Snrnp200 A T 2: 127,219,027 probably null Het
Snrnp200 G A 2: 127,219,028 probably null Het
Spaca3 T A 11: 80,867,685 V158E probably damaging Het
Sprtn C A 8: 124,903,031 N354K probably benign Het
Stab1 T A 14: 31,141,144 Y2166F possibly damaging Het
Tmem106c G A 15: 97,968,667 probably null Het
Tnc A G 4: 63,999,931 S1248P probably damaging Het
Tshr T C 12: 91,537,316 F343L probably benign Het
Ttn C A 2: 76,725,354 A30436S probably damaging Het
Ubxn2a A T 12: 4,885,839 M68K probably benign Het
Ucp2 T C 7: 100,498,814 V238A probably damaging Het
Urgcp C A 11: 5,717,242 L365F probably damaging Het
Vezt A T 10: 93,990,164 D328E probably damaging Het
Vmn1r168 G T 7: 23,540,759 V14L probably benign Het
Vps13b T C 15: 35,792,059 F2158L probably benign Het
Other mutations in Atp2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Atp2a1 APN 7 126447216 nonsense probably null
IGL00474:Atp2a1 APN 7 126450294 nonsense probably null
IGL00500:Atp2a1 APN 7 126447216 nonsense probably null
IGL01112:Atp2a1 APN 7 126450307 missense probably benign 0.13
IGL01380:Atp2a1 APN 7 126448770 missense possibly damaging 0.84
IGL01503:Atp2a1 APN 7 126448578 missense probably damaging 1.00
IGL01630:Atp2a1 APN 7 126450265 missense probably benign 0.00
IGL01679:Atp2a1 APN 7 126456809 missense probably benign 0.00
IGL01729:Atp2a1 APN 7 126457934 missense probably damaging 0.99
IGL02290:Atp2a1 APN 7 126452649 splice site probably benign
IGL02929:Atp2a1 APN 7 126456944 missense probably damaging 1.00
IGL02951:Atp2a1 APN 7 126450227 missense possibly damaging 0.58
IGL03249:Atp2a1 APN 7 126462805 missense probably benign 0.12
1mM(1):Atp2a1 UTSW 7 126446909 missense probably damaging 1.00
R0052:Atp2a1 UTSW 7 126457897 splice site probably benign
R0052:Atp2a1 UTSW 7 126457897 splice site probably benign
R0070:Atp2a1 UTSW 7 126447452 missense probably benign 0.03
R0070:Atp2a1 UTSW 7 126447452 missense probably benign 0.03
R0121:Atp2a1 UTSW 7 126457944 missense probably damaging 1.00
R0398:Atp2a1 UTSW 7 126450418 unclassified probably benign
R0578:Atp2a1 UTSW 7 126450143 missense probably benign
R0626:Atp2a1 UTSW 7 126446990 critical splice acceptor site probably null
R0739:Atp2a1 UTSW 7 126448256 missense possibly damaging 0.87
R1558:Atp2a1 UTSW 7 126452672 missense possibly damaging 0.88
R1700:Atp2a1 UTSW 7 126462909 missense probably damaging 1.00
R1748:Atp2a1 UTSW 7 126459608 missense possibly damaging 0.67
R1799:Atp2a1 UTSW 7 126450142 missense probably benign 0.27
R2058:Atp2a1 UTSW 7 126447672 missense possibly damaging 0.60
R2143:Atp2a1 UTSW 7 126448725 nonsense probably null
R2427:Atp2a1 UTSW 7 126446583 makesense probably null
R3113:Atp2a1 UTSW 7 126448369 missense probably damaging 1.00
R4501:Atp2a1 UTSW 7 126453383 missense probably benign 0.00
R4604:Atp2a1 UTSW 7 126448623 missense probably damaging 0.96
R4934:Atp2a1 UTSW 7 126453428 missense probably benign
R4939:Atp2a1 UTSW 7 126450116 missense probably benign
R5646:Atp2a1 UTSW 7 126453105 missense probably benign
R6093:Atp2a1 UTSW 7 126446921 missense probably damaging 1.00
R6556:Atp2a1 UTSW 7 126450262 missense probably benign 0.37
R6908:Atp2a1 UTSW 7 126448535 critical splice donor site probably null
R6911:Atp2a1 UTSW 7 126456836 missense probably damaging 1.00
R7206:Atp2a1 UTSW 7 126447972 missense probably benign 0.01
R7354:Atp2a1 UTSW 7 126448856 missense probably damaging 1.00
R7363:Atp2a1 UTSW 7 126462889 missense possibly damaging 0.88
R7501:Atp2a1 UTSW 7 126450172 missense probably benign 0.29
R7560:Atp2a1 UTSW 7 126459656 missense possibly damaging 0.95
R7716:Atp2a1 UTSW 7 126462187 missense possibly damaging 0.86
R7772:Atp2a1 UTSW 7 126448535 critical splice donor site probably null
R8039:Atp2a1 UTSW 7 126448805 missense probably damaging 0.99
X0022:Atp2a1 UTSW 7 126448250 missense possibly damaging 0.49
X0060:Atp2a1 UTSW 7 126462882 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCTGGCATCAAGGTAGGGAG -3'
(R):5'- GGCCACTGATGAAGAACATGA -3'

Sequencing Primer
(F):5'- GCATGATGAGATGCAGAGAGC -3'
(R):5'- TTATTGCAAAACAAGGAATGACAGG -3'
Posted On2014-06-23