Incidental Mutation 'R1808:Ppp2r2a'
ID203629
Institutional Source Beutler Lab
Gene Symbol Ppp2r2a
Ensembl Gene ENSMUSG00000022052
Gene Nameprotein phosphatase 2, regulatory subunit B, alpha
Synonyms2410004D02Rik
MMRRC Submission 039837-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1808 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location67014056-67072444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67038963 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 31 (I31T)
Ref Sequence ENSEMBL: ENSMUSP00000153191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089230] [ENSMUST00000225251] [ENSMUST00000225380]
Predicted Effect probably damaging
Transcript: ENSMUST00000089230
AA Change: I31T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086640
Gene: ENSMUSG00000022052
AA Change: I31T

DomainStartEndE-ValueType
WD40 21 56 1.33e1 SMART
WD40 83 123 6.88e0 SMART
WD40 165 204 2.3e0 SMART
WD40 215 255 8.88e0 SMART
WD40 274 312 5.11e1 SMART
WD40 339 370 1.42e2 SMART
WD40 406 443 2.47e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000225251
Predicted Effect probably damaging
Transcript: ENSMUST00000225380
AA Change: I31T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225469
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik G T 5: 146,184,881 Y69* probably null Het
2310011J03Rik A G 10: 80,320,181 probably null Het
A2ml1 A C 6: 128,543,299 D1367E probably damaging Het
Adam6a C G 12: 113,544,714 L236V probably benign Het
Arf3 T C 15: 98,741,073 N101S probably benign Het
Arhgap42 T C 9: 9,180,050 E76G probably damaging Het
Atp2a1 A G 7: 126,453,401 F382S probably damaging Het
Bud13 T A 9: 46,288,407 F355L probably benign Het
C2 G A 17: 34,864,532 P349S probably damaging Het
Cbl C A 9: 44,164,229 G373V probably damaging Het
Ccdc3 T A 2: 5,138,085 L51Q probably damaging Het
Ccdc34 T A 2: 110,044,256 M320K probably benign Het
Cntln A G 4: 85,096,763 E1097G probably damaging Het
Ctsc A C 7: 88,299,542 K195Q possibly damaging Het
Ctsf C T 19: 4,856,534 P163L probably benign Het
Dcxr A T 11: 120,725,612 probably null Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dnah8 T C 17: 30,684,186 L933P probably damaging Het
Dtna T C 18: 23,569,640 L76P probably damaging Het
Fcgbp T A 7: 28,085,090 C192S probably benign Het
Galnt5 T A 2: 58,026,125 D683E probably benign Het
Greb1l G A 18: 10,542,143 A1297T probably benign Het
Grik4 T C 9: 42,629,026 N286S probably benign Het
Hrc A T 7: 45,336,778 E451V probably damaging Het
Hrh3 G A 2: 180,099,784 probably benign Het
Ints13 A G 6: 146,554,197 I152T probably damaging Het
Irgm1 A T 11: 48,866,432 V184D probably damaging Het
Itga5 C T 15: 103,350,399 A791T probably damaging Het
Kcp T C 6: 29,505,655 T73A probably benign Het
Kidins220 A G 12: 25,003,009 T433A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2d T C 15: 98,866,686 D12G probably damaging Het
Mms19 A G 19: 41,966,259 S74P probably damaging Het
Myh1 G T 11: 67,211,474 E864* probably null Het
Nek1 A G 8: 61,016,230 D107G probably damaging Het
Npc1 T C 18: 12,194,092 N1149D probably damaging Het
Olfr127 T A 17: 37,903,770 S75T probably damaging Het
Olfr1280 T C 2: 111,315,998 V173A probably benign Het
Olfr401 C A 11: 74,121,431 S47R probably damaging Het
Olfr507 A C 7: 108,622,610 K266T possibly damaging Het
Osbp T C 19: 11,970,778 S150P probably damaging Het
Paf1 T C 7: 28,396,822 Y287H probably damaging Het
Pdgfrb T C 18: 61,068,102 V420A probably benign Het
Pdss1 G T 2: 22,906,834 E120* probably null Het
Pink1 A T 4: 138,317,319 V339E probably damaging Het
Pkn3 C T 2: 30,079,651 R58C probably damaging Het
Pm20d1 G A 1: 131,802,427 V235I probably benign Het
Rbms3 T C 9: 116,822,826 E152G probably damaging Het
Rfx1 A C 8: 84,095,048 Q804H probably damaging Het
Rpe G T 1: 66,715,197 V143L probably benign Het
Sap30l G T 11: 57,809,945 V142L probably benign Het
Sh3tc1 T C 5: 35,705,924 Q973R probably benign Het
Slc10a2 T C 8: 5,104,856 T110A probably damaging Het
Snrnp200 A T 2: 127,219,027 probably null Het
Snrnp200 G A 2: 127,219,028 probably null Het
Spaca3 T A 11: 80,867,685 V158E probably damaging Het
Sprtn C A 8: 124,903,031 N354K probably benign Het
Stab1 T A 14: 31,141,144 Y2166F possibly damaging Het
Tmem106c G A 15: 97,968,667 probably null Het
Tnc A G 4: 63,999,931 S1248P probably damaging Het
Tshr T C 12: 91,537,316 F343L probably benign Het
Ttn C A 2: 76,725,354 A30436S probably damaging Het
Ubxn2a A T 12: 4,885,839 M68K probably benign Het
Ucp2 T C 7: 100,498,814 V238A probably damaging Het
Urgcp C A 11: 5,717,242 L365F probably damaging Het
Vezt A T 10: 93,990,164 D328E probably damaging Het
Vmn1r168 G T 7: 23,540,759 V14L probably benign Het
Vps13b T C 15: 35,792,059 F2158L probably benign Het
Other mutations in Ppp2r2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Ppp2r2a APN 14 67070277 missense probably damaging 0.96
IGL01997:Ppp2r2a APN 14 67016519 missense probably benign
IGL02024:Ppp2r2a APN 14 67038912 missense probably benign 0.06
IGL02178:Ppp2r2a APN 14 67023097 missense probably damaging 1.00
IGL03148:Ppp2r2a APN 14 67022295 missense probably benign 0.00
IGL03304:Ppp2r2a APN 14 67016528 missense probably benign 0.13
limber UTSW 14 67019804 missense probably damaging 1.00
R1216:Ppp2r2a UTSW 14 67028998 nonsense probably null
R1576:Ppp2r2a UTSW 14 67038869 splice site probably benign
R1629:Ppp2r2a UTSW 14 67019759 missense possibly damaging 0.93
R1662:Ppp2r2a UTSW 14 67016603 missense probably benign
R1937:Ppp2r2a UTSW 14 67016429 missense possibly damaging 0.93
R2121:Ppp2r2a UTSW 14 67023128 missense probably damaging 1.00
R2134:Ppp2r2a UTSW 14 67016475 missense possibly damaging 0.63
R3150:Ppp2r2a UTSW 14 67023765 missense probably damaging 1.00
R3694:Ppp2r2a UTSW 14 67019750 missense probably damaging 1.00
R3695:Ppp2r2a UTSW 14 67019750 missense probably damaging 1.00
R3825:Ppp2r2a UTSW 14 67022443 missense probably damaging 0.98
R4031:Ppp2r2a UTSW 14 67028976 missense probably damaging 1.00
R4209:Ppp2r2a UTSW 14 67028879 missense probably damaging 1.00
R4353:Ppp2r2a UTSW 14 67028937 missense probably damaging 1.00
R4639:Ppp2r2a UTSW 14 67038957 missense probably damaging 1.00
R4976:Ppp2r2a UTSW 14 67016637 missense possibly damaging 0.71
R5001:Ppp2r2a UTSW 14 67022308 nonsense probably null
R5106:Ppp2r2a UTSW 14 67023097 missense probably damaging 1.00
R5322:Ppp2r2a UTSW 14 67038873 critical splice donor site probably null
R5360:Ppp2r2a UTSW 14 67016571 nonsense probably null
R5429:Ppp2r2a UTSW 14 67023756 missense probably damaging 1.00
R5439:Ppp2r2a UTSW 14 67022323 missense possibly damaging 0.70
R6250:Ppp2r2a UTSW 14 67038954 missense probably damaging 1.00
R6582:Ppp2r2a UTSW 14 67019804 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGGTCCAGCGTTAAAGC -3'
(R):5'- CCCACAAATAAGTGTCTGGTTTC -3'

Sequencing Primer
(F):5'- GCAACACTGAACTGTCAG -3'
(R):5'- ATCTTCCTGATTGGTTGAATGGC -3'
Posted On2014-06-23