Incidental Mutation 'R1809:Stk17b'
ID 203648
Institutional Source Beutler Lab
Gene Symbol Stk17b
Ensembl Gene ENSMUSG00000026094
Gene Name serine/threonine kinase 17b (apoptosis-inducing)
Synonyms 3110009A03Rik, Drak2
MMRRC Submission 039838-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R1809 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 53794671-53824374 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 53805140 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 140 (K140N)
Ref Sequence ENSEMBL: ENSMUSP00000027263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027263] [ENSMUST00000185920]
AlphaFold Q8BG48
Predicted Effect possibly damaging
Transcript: ENSMUST00000027263
AA Change: K140N

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027263
Gene: ENSMUSG00000026094
AA Change: K140N

DomainStartEndE-ValueType
S_TKc 33 293 5.77e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185920
AA Change: K12N

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139880
Gene: ENSMUSG00000026094
AA Change: K12N

DomainStartEndE-ValueType
S_TKc 1 93 5.8e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187066
Meta Mutation Damage Score 0.1520 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (107/111)
MGI Phenotype PHENOTYPE: Homozygous null mice display abnormal T cell numbers, increased T cell proliferation, abnormal cytokine physiology, and decreased susceptibility to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 A G 5: 36,000,614 (GRCm39) probably benign Het
Adamts20 C T 15: 94,238,968 (GRCm39) S750N probably damaging Het
Adh6a G A 3: 138,036,722 (GRCm39) R370H possibly damaging Het
Akr1b7 A G 6: 34,396,046 (GRCm39) N183D probably damaging Het
Aktip A T 8: 91,856,348 (GRCm39) I43N probably damaging Het
Ankrd26 A T 6: 118,502,883 (GRCm39) probably benign Het
Ano9 G A 7: 140,688,717 (GRCm39) T144I possibly damaging Het
Anpep G T 7: 79,491,571 (GRCm39) D143E probably benign Het
Aox1 C A 1: 58,333,484 (GRCm39) Q234K probably benign Het
Ap1g1 C G 8: 110,559,814 (GRCm39) probably benign Het
Arhgef4 G A 1: 34,849,636 (GRCm39) probably null Het
Arsj A G 3: 126,231,944 (GRCm39) Y230C possibly damaging Het
Asmt C T X: 169,109,480 (GRCm39) probably benign Het
Astl A T 2: 127,187,405 (GRCm39) K72N probably damaging Het
Atp2b2 G A 6: 113,780,704 (GRCm39) probably benign Het
Baiap2l1 A C 5: 144,261,365 (GRCm39) probably null Het
C7 A T 15: 5,063,821 (GRCm39) N193K probably damaging Het
Cacna2d4 G T 6: 119,247,785 (GRCm39) R362L probably damaging Het
Cct4 T A 11: 22,947,615 (GRCm39) D189E probably benign Het
Cd300lg G A 11: 101,933,938 (GRCm39) G62S probably benign Het
Cdk14 T A 5: 5,060,901 (GRCm39) M307L probably damaging Het
Cfi G A 3: 129,666,768 (GRCm39) probably null Het
Clec2g G T 6: 128,957,273 (GRCm39) probably null Het
Cntnap2 T C 6: 46,965,609 (GRCm39) S807P probably damaging Het
Col6a3 T A 1: 90,755,671 (GRCm39) H206L probably damaging Het
Ct55 A G X: 52,735,716 (GRCm39) E99G probably benign Het
Cyp2c23 A T 19: 44,009,997 (GRCm39) probably benign Het
Degs1l T C 1: 180,887,252 (GRCm39) I279T probably damaging Het
Dlec1 T C 9: 118,965,767 (GRCm39) V1058A probably benign Het
Dpp9 A G 17: 56,506,038 (GRCm39) Y454H probably damaging Het
Drosha G A 15: 12,890,198 (GRCm39) G920R probably null Het
Duox2 A G 2: 122,114,378 (GRCm39) S1142P possibly damaging Het
Fam13a C T 6: 58,942,045 (GRCm39) probably null Het
Filip1l A G 16: 57,327,023 (GRCm39) R18G probably benign Het
Foxa1 A G 12: 57,589,527 (GRCm39) V231A probably damaging Het
Gm4787 A T 12: 81,425,303 (GRCm39) M285K possibly damaging Het
Gm5084 T A 13: 60,360,320 (GRCm39) noncoding transcript Het
Gm6788 G A 19: 28,740,586 (GRCm39) noncoding transcript Het
Gm9922 G T 14: 101,966,841 (GRCm39) probably benign Het
Gtf3c4 A T 2: 28,723,988 (GRCm39) Y440* probably null Het
Helq A G 5: 100,921,820 (GRCm39) S795P probably damaging Het
Helz T A 11: 107,489,997 (GRCm39) S151T possibly damaging Het
Irgm1 T C 11: 48,757,440 (GRCm39) T124A probably benign Het
Itgam C T 7: 127,670,109 (GRCm39) P134S possibly damaging Het
Kdm6a T C X: 18,102,923 (GRCm39) Y217H probably benign Het
Kif6 T C 17: 50,208,812 (GRCm39) L744P probably benign Het
Kmt2c C T 5: 25,489,190 (GRCm39) R1203H probably damaging Het
Ksr2 A G 5: 117,693,535 (GRCm39) T328A probably damaging Het
Lig1 T C 7: 13,034,281 (GRCm39) probably benign Het
Lpar3 G A 3: 145,946,303 (GRCm39) probably benign Het
Lrrk2 T C 15: 91,584,095 (GRCm39) F285S possibly damaging Het
Marchf7 A G 2: 60,062,637 (GRCm39) D148G probably benign Het
Mcee T C 7: 64,050,049 (GRCm39) L60S probably damaging Het
Mob2 A G 7: 141,570,111 (GRCm39) I81T probably damaging Het
Mphosph8 T A 14: 56,909,909 (GRCm39) D87E probably damaging Het
Msantd5f9 A G 4: 73,835,754 (GRCm39) F237L probably benign Het
Myo1g T C 11: 6,462,283 (GRCm39) T560A probably benign Het
Nagk C T 6: 83,774,169 (GRCm39) T42I probably benign Het
Naip1 G T 13: 100,562,747 (GRCm39) T806K probably benign Het
Ncor2 A G 5: 125,195,857 (GRCm39) probably benign Het
Ocln G T 13: 100,647,967 (GRCm39) Y401* probably null Het
Odad2 T A 18: 7,211,630 (GRCm39) Y748F probably benign Het
Oma1 T A 4: 103,182,374 (GRCm39) N292K probably damaging Het
Or8b55 G A 9: 38,727,443 (GRCm39) V215I probably benign Het
Ovch2 T A 7: 107,389,412 (GRCm39) probably null Het
Pcdhb16 T C 18: 37,611,441 (GRCm39) F134L probably damaging Het
Pipox A T 11: 77,772,360 (GRCm39) Y337N probably benign Het
Polr3b A G 10: 84,528,865 (GRCm39) D763G probably damaging Het
Pygo1 T A 9: 72,852,078 (GRCm39) N88K probably damaging Het
Rab3gap1 T C 1: 127,862,251 (GRCm39) M674T probably damaging Het
Rbm25 T C 12: 83,719,501 (GRCm39) probably benign Het
Rbm26 C T 14: 105,354,542 (GRCm39) probably benign Het
Rbms2 G A 10: 127,974,055 (GRCm39) T187I possibly damaging Het
Rnase11 T A 14: 51,287,184 (GRCm39) R123S probably benign Het
Rngtt A G 4: 33,443,614 (GRCm39) N485D probably benign Het
Rp1l1 A T 14: 64,265,415 (GRCm39) M334L probably benign Het
Rps9 T A 7: 3,707,726 (GRCm39) L56Q probably damaging Het
Saysd1 C A 14: 20,133,170 (GRCm39) probably benign Het
Sema4d C T 13: 51,867,727 (GRCm39) probably null Het
Shisa5 A T 9: 108,869,998 (GRCm39) D34V probably damaging Het
Skil A G 3: 31,171,655 (GRCm39) D547G probably damaging Het
Slc2a5 T A 4: 150,227,514 (GRCm39) F444L probably damaging Het
Slc9b2 T G 3: 135,022,892 (GRCm39) C10G possibly damaging Het
Sorcs2 G T 5: 36,386,564 (GRCm39) probably benign Het
Stradb T A 1: 59,033,549 (GRCm39) L404Q possibly damaging Het
Synj2 T C 17: 6,076,826 (GRCm39) M432T possibly damaging Het
Tanc1 G T 2: 59,630,441 (GRCm39) R800L probably damaging Het
Tenm4 A G 7: 96,522,987 (GRCm39) M1473V probably benign Het
Tesc A G 5: 118,199,667 (GRCm39) I190V probably benign Het
Tex15 T C 8: 34,064,262 (GRCm39) F1231L probably benign Het
Thrsp T C 7: 97,066,332 (GRCm39) I127V probably benign Het
Tlr6 A T 5: 65,111,055 (GRCm39) C617* probably null Het
Trank1 A T 9: 111,221,893 (GRCm39) I2877F probably benign Het
Tut4 T A 4: 108,406,552 (GRCm39) H1373Q probably damaging Het
Ucp1 T C 8: 84,024,496 (GRCm39) S274P probably damaging Het
Ucp2 T A 7: 100,147,606 (GRCm39) V195E probably damaging Het
Vars2 T C 17: 35,973,108 (GRCm39) T394A probably damaging Het
Vmn1r1 A G 1: 181,985,371 (GRCm39) V98A possibly damaging Het
Vmn1r225 A G 17: 20,722,918 (GRCm39) I120V probably benign Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r25 A G 6: 123,802,337 (GRCm39) V522A probably benign Het
Vmn2r70 T C 7: 85,215,130 (GRCm39) I135V probably benign Het
Vwf T C 6: 125,567,138 (GRCm39) probably benign Het
Zfp446 T C 7: 12,713,048 (GRCm39) F29L probably damaging Het
Other mutations in Stk17b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Stk17b APN 1 53,803,299 (GRCm39) missense probably damaging 0.99
IGL00767:Stk17b APN 1 53,803,182 (GRCm39) splice site probably benign
IGL01012:Stk17b APN 1 53,800,196 (GRCm39) missense probably benign 0.06
IGL01431:Stk17b APN 1 53,805,074 (GRCm39) splice site probably benign
IGL01914:Stk17b APN 1 53,800,226 (GRCm39) missense probably damaging 0.98
IGL02236:Stk17b APN 1 53,803,247 (GRCm39) missense probably damaging 1.00
IGL02827:Stk17b APN 1 53,815,701 (GRCm39) missense probably benign 0.03
R0013:Stk17b UTSW 1 53,803,291 (GRCm39) missense probably benign 0.36
R0545:Stk17b UTSW 1 53,801,742 (GRCm39) splice site probably benign
R0831:Stk17b UTSW 1 53,796,651 (GRCm39) missense probably damaging 1.00
R1035:Stk17b UTSW 1 53,801,758 (GRCm39) missense probably benign 0.22
R1375:Stk17b UTSW 1 53,805,106 (GRCm39) missense possibly damaging 0.83
R1576:Stk17b UTSW 1 53,796,749 (GRCm39) missense probably damaging 1.00
R1988:Stk17b UTSW 1 53,800,241 (GRCm39) missense probably damaging 1.00
R2033:Stk17b UTSW 1 53,800,235 (GRCm39) missense probably damaging 1.00
R2105:Stk17b UTSW 1 53,815,764 (GRCm39) missense probably benign 0.01
R2255:Stk17b UTSW 1 53,815,731 (GRCm39) missense probably benign 0.00
R4395:Stk17b UTSW 1 53,803,274 (GRCm39) missense probably damaging 0.98
R4521:Stk17b UTSW 1 53,803,197 (GRCm39) missense probably damaging 1.00
R4777:Stk17b UTSW 1 53,810,867 (GRCm39) missense probably damaging 1.00
R4871:Stk17b UTSW 1 53,796,693 (GRCm39) missense probably benign 0.14
R4892:Stk17b UTSW 1 53,810,770 (GRCm39) missense probably damaging 0.99
R4999:Stk17b UTSW 1 53,800,306 (GRCm39) splice site probably null
R5122:Stk17b UTSW 1 53,815,717 (GRCm39) missense probably damaging 1.00
R5621:Stk17b UTSW 1 53,810,943 (GRCm39) nonsense probably null
R6636:Stk17b UTSW 1 53,800,247 (GRCm39) missense probably damaging 1.00
R6924:Stk17b UTSW 1 53,800,218 (GRCm39) missense possibly damaging 0.54
R7283:Stk17b UTSW 1 53,796,674 (GRCm39) missense probably benign
R7322:Stk17b UTSW 1 53,805,104 (GRCm39) missense probably benign 0.16
R7671:Stk17b UTSW 1 53,805,159 (GRCm39) missense probably damaging 0.99
R8984:Stk17b UTSW 1 53,796,784 (GRCm39) missense probably benign 0.05
R9476:Stk17b UTSW 1 53,796,898 (GRCm39) missense probably damaging 1.00
R9510:Stk17b UTSW 1 53,796,898 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTTATCCCACATGCAGC -3'
(R):5'- ACCTGACATTTACATGGCTGTG -3'

Sequencing Primer
(F):5'- GCACCCACTGTAGTCTAGAGGAC -3'
(R):5'- CATTTACATGGCTGTGTGGTTTTCAC -3'
Posted On 2014-06-23