Incidental Mutation 'R1809:Cntnap2'
ID 203684
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms Caspr2, 5430425M22Rik
MMRRC Submission 039838-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1809 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 45036995-47278330 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46965609 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 807 (S807P)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000114641
AA Change: S807P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: S807P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Meta Mutation Damage Score 0.2629 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (107/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 A G 5: 36,000,614 (GRCm39) probably benign Het
Adamts20 C T 15: 94,238,968 (GRCm39) S750N probably damaging Het
Adh6a G A 3: 138,036,722 (GRCm39) R370H possibly damaging Het
Akr1b7 A G 6: 34,396,046 (GRCm39) N183D probably damaging Het
Aktip A T 8: 91,856,348 (GRCm39) I43N probably damaging Het
Ankrd26 A T 6: 118,502,883 (GRCm39) probably benign Het
Ano9 G A 7: 140,688,717 (GRCm39) T144I possibly damaging Het
Anpep G T 7: 79,491,571 (GRCm39) D143E probably benign Het
Aox1 C A 1: 58,333,484 (GRCm39) Q234K probably benign Het
Ap1g1 C G 8: 110,559,814 (GRCm39) probably benign Het
Arhgef4 G A 1: 34,849,636 (GRCm39) probably null Het
Arsj A G 3: 126,231,944 (GRCm39) Y230C possibly damaging Het
Asmt C T X: 169,109,480 (GRCm39) probably benign Het
Astl A T 2: 127,187,405 (GRCm39) K72N probably damaging Het
Atp2b2 G A 6: 113,780,704 (GRCm39) probably benign Het
Baiap2l1 A C 5: 144,261,365 (GRCm39) probably null Het
C7 A T 15: 5,063,821 (GRCm39) N193K probably damaging Het
Cacna2d4 G T 6: 119,247,785 (GRCm39) R362L probably damaging Het
Cct4 T A 11: 22,947,615 (GRCm39) D189E probably benign Het
Cd300lg G A 11: 101,933,938 (GRCm39) G62S probably benign Het
Cdk14 T A 5: 5,060,901 (GRCm39) M307L probably damaging Het
Cfi G A 3: 129,666,768 (GRCm39) probably null Het
Clec2g G T 6: 128,957,273 (GRCm39) probably null Het
Col6a3 T A 1: 90,755,671 (GRCm39) H206L probably damaging Het
Ct55 A G X: 52,735,716 (GRCm39) E99G probably benign Het
Cyp2c23 A T 19: 44,009,997 (GRCm39) probably benign Het
Degs1l T C 1: 180,887,252 (GRCm39) I279T probably damaging Het
Dlec1 T C 9: 118,965,767 (GRCm39) V1058A probably benign Het
Dpp9 A G 17: 56,506,038 (GRCm39) Y454H probably damaging Het
Drosha G A 15: 12,890,198 (GRCm39) G920R probably null Het
Duox2 A G 2: 122,114,378 (GRCm39) S1142P possibly damaging Het
Fam13a C T 6: 58,942,045 (GRCm39) probably null Het
Filip1l A G 16: 57,327,023 (GRCm39) R18G probably benign Het
Foxa1 A G 12: 57,589,527 (GRCm39) V231A probably damaging Het
Gm4787 A T 12: 81,425,303 (GRCm39) M285K possibly damaging Het
Gm5084 T A 13: 60,360,320 (GRCm39) noncoding transcript Het
Gm6788 G A 19: 28,740,586 (GRCm39) noncoding transcript Het
Gm9922 G T 14: 101,966,841 (GRCm39) probably benign Het
Gtf3c4 A T 2: 28,723,988 (GRCm39) Y440* probably null Het
Helq A G 5: 100,921,820 (GRCm39) S795P probably damaging Het
Helz T A 11: 107,489,997 (GRCm39) S151T possibly damaging Het
Irgm1 T C 11: 48,757,440 (GRCm39) T124A probably benign Het
Itgam C T 7: 127,670,109 (GRCm39) P134S possibly damaging Het
Kdm6a T C X: 18,102,923 (GRCm39) Y217H probably benign Het
Kif6 T C 17: 50,208,812 (GRCm39) L744P probably benign Het
Kmt2c C T 5: 25,489,190 (GRCm39) R1203H probably damaging Het
Ksr2 A G 5: 117,693,535 (GRCm39) T328A probably damaging Het
Lig1 T C 7: 13,034,281 (GRCm39) probably benign Het
Lpar3 G A 3: 145,946,303 (GRCm39) probably benign Het
Lrrk2 T C 15: 91,584,095 (GRCm39) F285S possibly damaging Het
Marchf7 A G 2: 60,062,637 (GRCm39) D148G probably benign Het
Mcee T C 7: 64,050,049 (GRCm39) L60S probably damaging Het
Mob2 A G 7: 141,570,111 (GRCm39) I81T probably damaging Het
Mphosph8 T A 14: 56,909,909 (GRCm39) D87E probably damaging Het
Msantd5f9 A G 4: 73,835,754 (GRCm39) F237L probably benign Het
Myo1g T C 11: 6,462,283 (GRCm39) T560A probably benign Het
Nagk C T 6: 83,774,169 (GRCm39) T42I probably benign Het
Naip1 G T 13: 100,562,747 (GRCm39) T806K probably benign Het
Ncor2 A G 5: 125,195,857 (GRCm39) probably benign Het
Ocln G T 13: 100,647,967 (GRCm39) Y401* probably null Het
Odad2 T A 18: 7,211,630 (GRCm39) Y748F probably benign Het
Oma1 T A 4: 103,182,374 (GRCm39) N292K probably damaging Het
Or8b55 G A 9: 38,727,443 (GRCm39) V215I probably benign Het
Ovch2 T A 7: 107,389,412 (GRCm39) probably null Het
Pcdhb16 T C 18: 37,611,441 (GRCm39) F134L probably damaging Het
Pipox A T 11: 77,772,360 (GRCm39) Y337N probably benign Het
Polr3b A G 10: 84,528,865 (GRCm39) D763G probably damaging Het
Pygo1 T A 9: 72,852,078 (GRCm39) N88K probably damaging Het
Rab3gap1 T C 1: 127,862,251 (GRCm39) M674T probably damaging Het
Rbm25 T C 12: 83,719,501 (GRCm39) probably benign Het
Rbm26 C T 14: 105,354,542 (GRCm39) probably benign Het
Rbms2 G A 10: 127,974,055 (GRCm39) T187I possibly damaging Het
Rnase11 T A 14: 51,287,184 (GRCm39) R123S probably benign Het
Rngtt A G 4: 33,443,614 (GRCm39) N485D probably benign Het
Rp1l1 A T 14: 64,265,415 (GRCm39) M334L probably benign Het
Rps9 T A 7: 3,707,726 (GRCm39) L56Q probably damaging Het
Saysd1 C A 14: 20,133,170 (GRCm39) probably benign Het
Sema4d C T 13: 51,867,727 (GRCm39) probably null Het
Shisa5 A T 9: 108,869,998 (GRCm39) D34V probably damaging Het
Skil A G 3: 31,171,655 (GRCm39) D547G probably damaging Het
Slc2a5 T A 4: 150,227,514 (GRCm39) F444L probably damaging Het
Slc9b2 T G 3: 135,022,892 (GRCm39) C10G possibly damaging Het
Sorcs2 G T 5: 36,386,564 (GRCm39) probably benign Het
Stk17b T G 1: 53,805,140 (GRCm39) K140N possibly damaging Het
Stradb T A 1: 59,033,549 (GRCm39) L404Q possibly damaging Het
Synj2 T C 17: 6,076,826 (GRCm39) M432T possibly damaging Het
Tanc1 G T 2: 59,630,441 (GRCm39) R800L probably damaging Het
Tenm4 A G 7: 96,522,987 (GRCm39) M1473V probably benign Het
Tesc A G 5: 118,199,667 (GRCm39) I190V probably benign Het
Tex15 T C 8: 34,064,262 (GRCm39) F1231L probably benign Het
Thrsp T C 7: 97,066,332 (GRCm39) I127V probably benign Het
Tlr6 A T 5: 65,111,055 (GRCm39) C617* probably null Het
Trank1 A T 9: 111,221,893 (GRCm39) I2877F probably benign Het
Tut4 T A 4: 108,406,552 (GRCm39) H1373Q probably damaging Het
Ucp1 T C 8: 84,024,496 (GRCm39) S274P probably damaging Het
Ucp2 T A 7: 100,147,606 (GRCm39) V195E probably damaging Het
Vars2 T C 17: 35,973,108 (GRCm39) T394A probably damaging Het
Vmn1r1 A G 1: 181,985,371 (GRCm39) V98A possibly damaging Het
Vmn1r225 A G 17: 20,722,918 (GRCm39) I120V probably benign Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r25 A G 6: 123,802,337 (GRCm39) V522A probably benign Het
Vmn2r70 T C 7: 85,215,130 (GRCm39) I135V probably benign Het
Vwf T C 6: 125,567,138 (GRCm39) probably benign Het
Zfp446 T C 7: 12,713,048 (GRCm39) F29L probably damaging Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 45,992,197 (GRCm39) missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46,965,721 (GRCm39) missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47,169,972 (GRCm39) missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46,461,006 (GRCm39) missense probably benign
IGL00857:Cntnap2 APN 6 47,026,358 (GRCm39) missense probably benign 0.00
IGL01290:Cntnap2 APN 6 45,992,399 (GRCm39) missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47,169,947 (GRCm39) missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47,248,305 (GRCm39) nonsense probably null
IGL01859:Cntnap2 APN 6 46,965,655 (GRCm39) missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46,211,137 (GRCm39) missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 46,998,588 (GRCm39) missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46,211,254 (GRCm39) missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 46,998,670 (GRCm39) missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47,072,483 (GRCm39) missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46,147,179 (GRCm39) missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46,507,105 (GRCm39) missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45,969,007 (GRCm39) missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46,460,917 (GRCm39) missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45,037,326 (GRCm39) splice site probably null
R0352:Cntnap2 UTSW 6 45,969,018 (GRCm39) splice site probably null
R0389:Cntnap2 UTSW 6 45,986,571 (GRCm39) missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45,692,750 (GRCm39) missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46,506,839 (GRCm39) nonsense probably null
R0611:Cntnap2 UTSW 6 47,072,483 (GRCm39) missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46,965,694 (GRCm39) missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47,273,642 (GRCm39) splice site probably benign
R0976:Cntnap2 UTSW 6 47,248,164 (GRCm39) missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1195:Cntnap2 UTSW 6 46,460,902 (GRCm39) missense probably benign
R1387:Cntnap2 UTSW 6 47,084,848 (GRCm39) missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46,507,613 (GRCm39) missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 45,992,264 (GRCm39) missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47,084,826 (GRCm39) nonsense probably null
R1757:Cntnap2 UTSW 6 46,736,763 (GRCm39) missense probably damaging 1.00
R1813:Cntnap2 UTSW 6 46,507,567 (GRCm39) missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47,275,522 (GRCm39) missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47,275,379 (GRCm39) missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 45,992,200 (GRCm39) missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45,968,837 (GRCm39) missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4030:Cntnap2 UTSW 6 46,833,062 (GRCm39) missense probably benign
R4237:Cntnap2 UTSW 6 46,507,324 (GRCm39) intron probably benign
R4445:Cntnap2 UTSW 6 46,736,785 (GRCm39) missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45,037,251 (GRCm39) missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4918:Cntnap2 UTSW 6 46,506,969 (GRCm39) intron probably benign
R4999:Cntnap2 UTSW 6 45,897,768 (GRCm39) missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47,084,903 (GRCm39) missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45,897,860 (GRCm39) nonsense probably null
R5748:Cntnap2 UTSW 6 45,692,818 (GRCm39) missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46,506,749 (GRCm39) intron probably benign
R6118:Cntnap2 UTSW 6 47,170,011 (GRCm39) missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46,736,742 (GRCm39) missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47,248,232 (GRCm39) missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45,037,046 (GRCm39) splice site probably null
R6385:Cntnap2 UTSW 6 46,833,114 (GRCm39) missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46,736,694 (GRCm39) missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46,147,206 (GRCm39) missense probably benign 0.25
R6610:Cntnap2 UTSW 6 45,992,191 (GRCm39) missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46,965,580 (GRCm39) missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47,248,205 (GRCm39) missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46,460,963 (GRCm39) missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47,072,621 (GRCm39) missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46,324,079 (GRCm39) missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47,072,627 (GRCm39) missense probably damaging 0.98
R8356:Cntnap2 UTSW 6 47,026,307 (GRCm39) missense probably benign 0.03
R8479:Cntnap2 UTSW 6 46,736,707 (GRCm39) missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45,968,975 (GRCm39) missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47,026,156 (GRCm39) missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 45,978,161 (GRCm39) missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46,833,076 (GRCm39) missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46,460,983 (GRCm39) missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46,461,139 (GRCm39) intron probably benign
R9209:Cntnap2 UTSW 6 47,026,183 (GRCm39) missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 45,978,112 (GRCm39) missense probably benign 0.00
R9310:Cntnap2 UTSW 6 45,978,281 (GRCm39) missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 45,978,244 (GRCm39) missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46,211,217 (GRCm39) missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 45,992,165 (GRCm39) missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45,969,009 (GRCm39) missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46,965,726 (GRCm39) missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 45,992,373 (GRCm39) frame shift probably null
R9745:Cntnap2 UTSW 6 46,211,100 (GRCm39) missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47,026,261 (GRCm39) missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 46,998,599 (GRCm39) missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 45,986,452 (GRCm39) missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 46,998,688 (GRCm39) missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46,211,179 (GRCm39) missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47,248,082 (GRCm39) missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 45,992,233 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TAGGGATGCATGGCTACTGC -3'
(R):5'- TCCCTGCCGACTATCTTGAG -3'

Sequencing Primer
(F):5'- tgtgcgtgCGCAATATAG -3'
(R):5'- GAGGCCTCTCTGTGACCACATC -3'
Posted On 2014-06-23