Incidental Mutation 'R0110:Arpc1b'
ID20369
Institutional Source Beutler Lab
Gene Symbol Arpc1b
Ensembl Gene ENSMUSG00000029622
Gene Nameactin related protein 2/3 complex, subunit 1B
SynonymsSOP2Hs, L72, p41-ARC
MMRRC Submission 038396-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0110 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location145114215-145130705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145127715 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 361 (W361R)
Ref Sequence ENSEMBL: ENSMUSP00000143438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031627] [ENSMUST00000085679] [ENSMUST00000136074] [ENSMUST00000196111]
Predicted Effect probably benign
Transcript: ENSMUST00000031627
SMART Domains Protein: ENSMUSP00000031627
Gene: ENSMUSG00000029623

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 28 47 N/A INTRINSIC
low complexity region 52 69 N/A INTRINSIC
Pfam:PP28 84 163 3e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085679
AA Change: W357R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082822
Gene: ENSMUSG00000029622
AA Change: W357R

DomainStartEndE-ValueType
Blast:WD40 1 36 4e-14 BLAST
WD40 41 80 1.21e-7 SMART
WD40 85 124 1.54e0 SMART
WD40 130 170 1.56e-1 SMART
WD40 191 230 7.7e-1 SMART
Blast:WD40 233 271 9e-18 BLAST
WD40 317 358 3.55e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129033
Predicted Effect probably benign
Transcript: ENSMUST00000136074
SMART Domains Protein: ENSMUSP00000115022
Gene: ENSMUSG00000029622

DomainStartEndE-ValueType
Pfam:WD40 3 29 2.5e-3 PFAM
WD40 77 121 1.79e-1 SMART
WD40 142 181 7.7e-1 SMART
Blast:WD40 184 222 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138900
Predicted Effect unknown
Transcript: ENSMUST00000138922
AA Change: W85R
SMART Domains Protein: ENSMUSP00000115515
Gene: ENSMUSG00000029622
AA Change: W85R

DomainStartEndE-ValueType
PDB:2P9U|C 2 93 4e-43 PDB
SCOP:d1k8kc_ 35 93 2e-11 SMART
Blast:WD40 50 87 3e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143439
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144375
Predicted Effect probably damaging
Transcript: ENSMUST00000196111
AA Change: W361R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143438
Gene: ENSMUSG00000029622
AA Change: W361R

DomainStartEndE-ValueType
Blast:WD40 1 36 4e-14 BLAST
WD40 41 80 1.21e-7 SMART
WD40 85 124 1.54e0 SMART
WD40 130 170 1.56e-1 SMART
WD40 191 230 7.7e-1 SMART
Blast:WD40 237 275 2e-16 BLAST
WD40 321 362 3.55e1 SMART
Meta Mutation Damage Score 0.52 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. This subunit is a member of the SOP2 family of proteins and is most similar to the protein encoded by gene ARPC1A. The similarity between these two proteins suggests that they both may function as p41 subunit of the human Arp2/3 complex that has been implicated in the control of actin polymerization in cells. It is possible that the p41 subunit is involved in assembling and maintaining the structure of the Arp2/3 complex. Multiple versions of the p41 subunit may adapt the functions of the complex to different cell types or developmental stages. This protein also has a role in centrosomal homeostasis by being an activator and substrate of the Aurora A kinase. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,506 probably benign Het
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Baiap2l1 T C 5: 144,275,891 Y438C probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cntln C T 4: 85,096,757 T1095I probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dnah12 A G 14: 26,798,899 R1892G probably damaging Het
Dock4 A G 12: 40,621,312 probably benign Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Fam227b T A 2: 126,100,921 S319C probably damaging Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Gal3st2c C T 1: 94,009,497 P388L probably benign Het
Ggn C T 7: 29,171,296 P47S probably damaging Het
Gli3 T G 13: 15,724,785 L919R probably damaging Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 C A 1: 44,059,224 V905F probably benign Het
Gmip C T 8: 69,815,609 probably benign Het
Gpr39 C T 1: 125,677,500 T55M probably damaging Het
Grk4 A G 5: 34,716,213 T208A probably damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hadhb T C 5: 30,169,485 probably benign Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpa A T 2: 130,679,418 probably benign Het
Klhl10 A G 11: 100,456,932 T605A probably benign Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lap3 T C 5: 45,495,290 probably benign Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map3k6 T C 4: 133,243,794 L273P probably damaging Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mrc1 T A 2: 14,238,542 probably benign Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtcl1 C T 17: 66,358,114 E1149K possibly damaging Het
Naca C T 10: 128,044,790 A1897V probably benign Het
Ncapg T C 5: 45,693,147 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pla2g4a T A 1: 149,840,647 M688L possibly damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Prmt1 A G 7: 44,978,801 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Prom2 T G 2: 127,531,113 S679R possibly damaging Het
Psen2 T C 1: 180,238,914 T153A probably damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Stam2 A T 2: 52,719,986 probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Tas2r123 T C 6: 132,847,332 V64A probably benign Het
Tnnc1 A G 14: 31,211,408 D149G probably damaging Het
Tpp2 T A 1: 43,978,504 V756E probably benign Het
Tpp2 A G 1: 43,999,693 D1133G probably damaging Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Tsen15 A G 1: 152,371,797 V148A probably damaging Het
Ttn T A 2: 76,864,328 probably benign Het
Ube2u A G 4: 100,486,673 I90V probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Wdr41 T C 13: 95,018,111 probably benign Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp423 A G 8: 87,782,259 S486P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Other mutations in Arpc1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Arpc1b APN 5 145127869 utr 3 prime probably benign
IGL01625:Arpc1b APN 5 145121745 splice site probably null
IGL01859:Arpc1b APN 5 145123730 missense probably damaging 0.98
illusory UTSW 5 145122567 missense probably damaging 1.00
FR4304:Arpc1b UTSW 5 145126791 frame shift probably null
FR4340:Arpc1b UTSW 5 145126792 frame shift probably null
FR4737:Arpc1b UTSW 5 145126787 frame shift probably null
R0245:Arpc1b UTSW 5 145126860 missense probably damaging 1.00
R0469:Arpc1b UTSW 5 145127715 missense probably damaging 1.00
R0652:Arpc1b UTSW 5 145126860 missense probably damaging 1.00
R0827:Arpc1b UTSW 5 145125756 missense probably benign 0.34
R1117:Arpc1b UTSW 5 145125754 missense possibly damaging 0.95
R1453:Arpc1b UTSW 5 145125745 missense probably damaging 1.00
R1895:Arpc1b UTSW 5 145122633 missense probably null 0.99
R1946:Arpc1b UTSW 5 145122633 missense probably null 0.99
R2050:Arpc1b UTSW 5 145125919 missense probably damaging 1.00
R2112:Arpc1b UTSW 5 145123769 missense probably damaging 0.99
R4924:Arpc1b UTSW 5 145126815 missense probably benign 0.02
R6534:Arpc1b UTSW 5 145122567 missense probably damaging 1.00
R6883:Arpc1b UTSW 5 145126929 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGGCACTCTACATTCCCAATGCG -3'
(R):5'- TTAGCAAAGCAGCCCTTAGCCTC -3'

Sequencing Primer
(F):5'- GTTCCATAGCTAGGACTGTTCC -3'
(R):5'- CCCTTAGCCTCCCCGAC -3'
Posted On2013-04-11