Incidental Mutation 'R1809:Vwf'
ID 203691
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms B130011O06Rik, 6820430P06Rik
MMRRC Submission 039838-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.138) question?
Stock # R1809 (G1)
Quality Score 191
Status Validated
Chromosome 6
Chromosomal Location 125529911-125663642 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 125567138 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100941] [ENSMUST00000112253] [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000100941
SMART Domains Protein: ENSMUSP00000098502
Gene: ENSMUSG00000001930

DomainStartEndE-ValueType
VWD 38 196 3.43e-35 SMART
C8 236 310 1.11e-21 SMART
Pfam:TIL 313 366 2.8e-15 PFAM
Blast:VWC 368 404 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112253
SMART Domains Protein: ENSMUSP00000107872
Gene: ENSMUSG00000001930

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 2.7e-15 PFAM
Blast:VWC 353 389 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112254
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150548
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (107/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim2 A G 5: 36,000,614 (GRCm39) probably benign Het
Adamts20 C T 15: 94,238,968 (GRCm39) S750N probably damaging Het
Adh6a G A 3: 138,036,722 (GRCm39) R370H possibly damaging Het
Akr1b7 A G 6: 34,396,046 (GRCm39) N183D probably damaging Het
Aktip A T 8: 91,856,348 (GRCm39) I43N probably damaging Het
Ankrd26 A T 6: 118,502,883 (GRCm39) probably benign Het
Ano9 G A 7: 140,688,717 (GRCm39) T144I possibly damaging Het
Anpep G T 7: 79,491,571 (GRCm39) D143E probably benign Het
Aox1 C A 1: 58,333,484 (GRCm39) Q234K probably benign Het
Ap1g1 C G 8: 110,559,814 (GRCm39) probably benign Het
Arhgef4 G A 1: 34,849,636 (GRCm39) probably null Het
Arsj A G 3: 126,231,944 (GRCm39) Y230C possibly damaging Het
Asmt C T X: 169,109,480 (GRCm39) probably benign Het
Astl A T 2: 127,187,405 (GRCm39) K72N probably damaging Het
Atp2b2 G A 6: 113,780,704 (GRCm39) probably benign Het
Baiap2l1 A C 5: 144,261,365 (GRCm39) probably null Het
C7 A T 15: 5,063,821 (GRCm39) N193K probably damaging Het
Cacna2d4 G T 6: 119,247,785 (GRCm39) R362L probably damaging Het
Cct4 T A 11: 22,947,615 (GRCm39) D189E probably benign Het
Cd300lg G A 11: 101,933,938 (GRCm39) G62S probably benign Het
Cdk14 T A 5: 5,060,901 (GRCm39) M307L probably damaging Het
Cfi G A 3: 129,666,768 (GRCm39) probably null Het
Clec2g G T 6: 128,957,273 (GRCm39) probably null Het
Cntnap2 T C 6: 46,965,609 (GRCm39) S807P probably damaging Het
Col6a3 T A 1: 90,755,671 (GRCm39) H206L probably damaging Het
Ct55 A G X: 52,735,716 (GRCm39) E99G probably benign Het
Cyp2c23 A T 19: 44,009,997 (GRCm39) probably benign Het
Degs1l T C 1: 180,887,252 (GRCm39) I279T probably damaging Het
Dlec1 T C 9: 118,965,767 (GRCm39) V1058A probably benign Het
Dpp9 A G 17: 56,506,038 (GRCm39) Y454H probably damaging Het
Drosha G A 15: 12,890,198 (GRCm39) G920R probably null Het
Duox2 A G 2: 122,114,378 (GRCm39) S1142P possibly damaging Het
Fam13a C T 6: 58,942,045 (GRCm39) probably null Het
Filip1l A G 16: 57,327,023 (GRCm39) R18G probably benign Het
Foxa1 A G 12: 57,589,527 (GRCm39) V231A probably damaging Het
Gm4787 A T 12: 81,425,303 (GRCm39) M285K possibly damaging Het
Gm5084 T A 13: 60,360,320 (GRCm39) noncoding transcript Het
Gm6788 G A 19: 28,740,586 (GRCm39) noncoding transcript Het
Gm9922 G T 14: 101,966,841 (GRCm39) probably benign Het
Gtf3c4 A T 2: 28,723,988 (GRCm39) Y440* probably null Het
Helq A G 5: 100,921,820 (GRCm39) S795P probably damaging Het
Helz T A 11: 107,489,997 (GRCm39) S151T possibly damaging Het
Irgm1 T C 11: 48,757,440 (GRCm39) T124A probably benign Het
Itgam C T 7: 127,670,109 (GRCm39) P134S possibly damaging Het
Kdm6a T C X: 18,102,923 (GRCm39) Y217H probably benign Het
Kif6 T C 17: 50,208,812 (GRCm39) L744P probably benign Het
Kmt2c C T 5: 25,489,190 (GRCm39) R1203H probably damaging Het
Ksr2 A G 5: 117,693,535 (GRCm39) T328A probably damaging Het
Lig1 T C 7: 13,034,281 (GRCm39) probably benign Het
Lpar3 G A 3: 145,946,303 (GRCm39) probably benign Het
Lrrk2 T C 15: 91,584,095 (GRCm39) F285S possibly damaging Het
Marchf7 A G 2: 60,062,637 (GRCm39) D148G probably benign Het
Mcee T C 7: 64,050,049 (GRCm39) L60S probably damaging Het
Mob2 A G 7: 141,570,111 (GRCm39) I81T probably damaging Het
Mphosph8 T A 14: 56,909,909 (GRCm39) D87E probably damaging Het
Msantd5f9 A G 4: 73,835,754 (GRCm39) F237L probably benign Het
Myo1g T C 11: 6,462,283 (GRCm39) T560A probably benign Het
Nagk C T 6: 83,774,169 (GRCm39) T42I probably benign Het
Naip1 G T 13: 100,562,747 (GRCm39) T806K probably benign Het
Ncor2 A G 5: 125,195,857 (GRCm39) probably benign Het
Ocln G T 13: 100,647,967 (GRCm39) Y401* probably null Het
Odad2 T A 18: 7,211,630 (GRCm39) Y748F probably benign Het
Oma1 T A 4: 103,182,374 (GRCm39) N292K probably damaging Het
Or8b55 G A 9: 38,727,443 (GRCm39) V215I probably benign Het
Ovch2 T A 7: 107,389,412 (GRCm39) probably null Het
Pcdhb16 T C 18: 37,611,441 (GRCm39) F134L probably damaging Het
Pipox A T 11: 77,772,360 (GRCm39) Y337N probably benign Het
Polr3b A G 10: 84,528,865 (GRCm39) D763G probably damaging Het
Pygo1 T A 9: 72,852,078 (GRCm39) N88K probably damaging Het
Rab3gap1 T C 1: 127,862,251 (GRCm39) M674T probably damaging Het
Rbm25 T C 12: 83,719,501 (GRCm39) probably benign Het
Rbm26 C T 14: 105,354,542 (GRCm39) probably benign Het
Rbms2 G A 10: 127,974,055 (GRCm39) T187I possibly damaging Het
Rnase11 T A 14: 51,287,184 (GRCm39) R123S probably benign Het
Rngtt A G 4: 33,443,614 (GRCm39) N485D probably benign Het
Rp1l1 A T 14: 64,265,415 (GRCm39) M334L probably benign Het
Rps9 T A 7: 3,707,726 (GRCm39) L56Q probably damaging Het
Saysd1 C A 14: 20,133,170 (GRCm39) probably benign Het
Sema4d C T 13: 51,867,727 (GRCm39) probably null Het
Shisa5 A T 9: 108,869,998 (GRCm39) D34V probably damaging Het
Skil A G 3: 31,171,655 (GRCm39) D547G probably damaging Het
Slc2a5 T A 4: 150,227,514 (GRCm39) F444L probably damaging Het
Slc9b2 T G 3: 135,022,892 (GRCm39) C10G possibly damaging Het
Sorcs2 G T 5: 36,386,564 (GRCm39) probably benign Het
Stk17b T G 1: 53,805,140 (GRCm39) K140N possibly damaging Het
Stradb T A 1: 59,033,549 (GRCm39) L404Q possibly damaging Het
Synj2 T C 17: 6,076,826 (GRCm39) M432T possibly damaging Het
Tanc1 G T 2: 59,630,441 (GRCm39) R800L probably damaging Het
Tenm4 A G 7: 96,522,987 (GRCm39) M1473V probably benign Het
Tesc A G 5: 118,199,667 (GRCm39) I190V probably benign Het
Tex15 T C 8: 34,064,262 (GRCm39) F1231L probably benign Het
Thrsp T C 7: 97,066,332 (GRCm39) I127V probably benign Het
Tlr6 A T 5: 65,111,055 (GRCm39) C617* probably null Het
Trank1 A T 9: 111,221,893 (GRCm39) I2877F probably benign Het
Tut4 T A 4: 108,406,552 (GRCm39) H1373Q probably damaging Het
Ucp1 T C 8: 84,024,496 (GRCm39) S274P probably damaging Het
Ucp2 T A 7: 100,147,606 (GRCm39) V195E probably damaging Het
Vars2 T C 17: 35,973,108 (GRCm39) T394A probably damaging Het
Vmn1r1 A G 1: 181,985,371 (GRCm39) V98A possibly damaging Het
Vmn1r225 A G 17: 20,722,918 (GRCm39) I120V probably benign Het
Vmn2r102 A T 17: 19,897,881 (GRCm39) M299L probably benign Het
Vmn2r25 A G 6: 123,802,337 (GRCm39) V522A probably benign Het
Vmn2r70 T C 7: 85,215,130 (GRCm39) I135V probably benign Het
Zfp446 T C 7: 12,713,048 (GRCm39) F29L probably damaging Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125,635,835 (GRCm39) missense unknown
IGL00561:Vwf APN 6 125,619,684 (GRCm39) missense possibly damaging 0.88
IGL01104:Vwf APN 6 125,660,519 (GRCm39) missense probably damaging 1.00
IGL01404:Vwf APN 6 125,654,933 (GRCm39) missense probably damaging 1.00
IGL01539:Vwf APN 6 125,567,225 (GRCm39) missense possibly damaging 0.85
IGL01550:Vwf APN 6 125,656,252 (GRCm39) missense probably benign 0.00
IGL01563:Vwf APN 6 125,568,128 (GRCm39) missense probably damaging 1.00
IGL01637:Vwf APN 6 125,622,699 (GRCm39) missense probably damaging 1.00
IGL01720:Vwf APN 6 125,619,798 (GRCm39) missense possibly damaging 0.69
IGL01834:Vwf APN 6 125,567,133 (GRCm39) splice site probably benign
IGL02103:Vwf APN 6 125,623,318 (GRCm39) missense probably damaging 1.00
IGL02120:Vwf APN 6 125,592,997 (GRCm39) missense probably benign 0.26
IGL02174:Vwf APN 6 125,532,358 (GRCm39) missense probably damaging 1.00
IGL02203:Vwf APN 6 125,619,369 (GRCm39) missense probably damaging 1.00
IGL02420:Vwf APN 6 125,654,879 (GRCm39) missense probably benign 0.00
IGL02723:Vwf APN 6 125,619,893 (GRCm39) missense possibly damaging 0.85
IGL02818:Vwf APN 6 125,640,511 (GRCm39) missense probably benign
IGL02931:Vwf APN 6 125,592,931 (GRCm39) missense possibly damaging 0.68
IGL03015:Vwf APN 6 125,661,101 (GRCm39) splice site probably benign
IGL03038:Vwf APN 6 125,581,120 (GRCm39) missense possibly damaging 0.92
IGL03060:Vwf APN 6 125,640,523 (GRCm39) missense probably damaging 1.00
IGL03114:Vwf APN 6 125,576,326 (GRCm39) nonsense probably null
IGL03266:Vwf APN 6 125,655,040 (GRCm39) splice site probably benign
gingerman UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1628_Vwf_608 UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669_Vwf_448 UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R2130_vwf_946 UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
Russiahouse UTSW 6 125,616,304 (GRCm39) nonsense probably null
B5639:Vwf UTSW 6 125,619,947 (GRCm39) missense probably damaging 1.00
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0025:Vwf UTSW 6 125,659,775 (GRCm39) missense probably benign 0.05
R0087:Vwf UTSW 6 125,622,917 (GRCm39) missense probably benign 0.03
R0194:Vwf UTSW 6 125,620,260 (GRCm39) missense probably benign
R0206:Vwf UTSW 6 125,614,419 (GRCm39) missense probably damaging 1.00
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0233:Vwf UTSW 6 125,663,473 (GRCm39) missense possibly damaging 0.91
R0390:Vwf UTSW 6 125,603,324 (GRCm39) nonsense probably null
R0427:Vwf UTSW 6 125,650,902 (GRCm39) missense probably benign
R0437:Vwf UTSW 6 125,543,281 (GRCm39) missense probably damaging 1.00
R0470:Vwf UTSW 6 125,605,391 (GRCm39) missense possibly damaging 0.70
R0499:Vwf UTSW 6 125,615,077 (GRCm39) missense probably benign 0.10
R0554:Vwf UTSW 6 125,619,744 (GRCm39) missense probably benign 0.13
R0605:Vwf UTSW 6 125,662,800 (GRCm39) missense probably benign 0.02
R0711:Vwf UTSW 6 125,603,234 (GRCm39) missense probably benign 0.01
R0723:Vwf UTSW 6 125,543,225 (GRCm39) missense probably benign 0.01
R0973:Vwf UTSW 6 125,619,969 (GRCm39) missense probably damaging 1.00
R1054:Vwf UTSW 6 125,567,190 (GRCm39) missense probably damaging 1.00
R1115:Vwf UTSW 6 125,632,028 (GRCm39) missense unknown
R1156:Vwf UTSW 6 125,614,451 (GRCm39) missense probably damaging 1.00
R1191:Vwf UTSW 6 125,576,215 (GRCm39) missense probably damaging 1.00
R1240:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
R1398:Vwf UTSW 6 125,580,420 (GRCm39) missense probably benign 0.02
R1435:Vwf UTSW 6 125,619,212 (GRCm39) nonsense probably null
R1528:Vwf UTSW 6 125,585,254 (GRCm39) missense possibly damaging 0.69
R1575:Vwf UTSW 6 125,640,534 (GRCm39) nonsense probably null
R1575:Vwf UTSW 6 125,632,214 (GRCm39) missense unknown
R1628:Vwf UTSW 6 125,624,701 (GRCm39) unclassified probably benign
R1669:Vwf UTSW 6 125,624,869 (GRCm39) missense possibly damaging 0.92
R1699:Vwf UTSW 6 125,662,863 (GRCm39) missense possibly damaging 0.74
R1699:Vwf UTSW 6 125,620,032 (GRCm39) missense probably damaging 1.00
R1725:Vwf UTSW 6 125,623,245 (GRCm39) missense probably benign 0.05
R1742:Vwf UTSW 6 125,644,513 (GRCm39) missense probably benign 0.02
R1833:Vwf UTSW 6 125,619,000 (GRCm39) missense probably benign 0.14
R1866:Vwf UTSW 6 125,644,492 (GRCm39) missense possibly damaging 0.62
R1870:Vwf UTSW 6 125,619,902 (GRCm39) missense probably damaging 1.00
R1874:Vwf UTSW 6 125,605,335 (GRCm39) missense probably benign 0.00
R1941:Vwf UTSW 6 125,616,242 (GRCm39) missense possibly damaging 0.64
R2061:Vwf UTSW 6 125,568,151 (GRCm39) missense probably damaging 0.98
R2103:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2104:Vwf UTSW 6 125,623,293 (GRCm39) missense probably benign 0.31
R2130:Vwf UTSW 6 125,634,020 (GRCm39) missense probably damaging 1.00
R2159:Vwf UTSW 6 125,603,304 (GRCm39) missense probably damaging 0.99
R2178:Vwf UTSW 6 125,619,095 (GRCm39) missense possibly damaging 0.90
R2656:Vwf UTSW 6 125,532,324 (GRCm39) missense probably benign 0.00
R2913:Vwf UTSW 6 125,662,809 (GRCm39) missense probably benign 0.08
R2917:Vwf UTSW 6 125,585,106 (GRCm39) missense probably benign 0.07
R3726:Vwf UTSW 6 125,654,911 (GRCm39) utr 3 prime probably benign
R3735:Vwf UTSW 6 125,565,576 (GRCm39) missense probably damaging 1.00
R3774:Vwf UTSW 6 125,626,062 (GRCm39) splice site probably null
R3934:Vwf UTSW 6 125,532,462 (GRCm39) missense probably damaging 1.00
R4291:Vwf UTSW 6 125,619,285 (GRCm39) missense probably damaging 1.00
R4384:Vwf UTSW 6 125,632,079 (GRCm39) missense unknown
R4743:Vwf UTSW 6 125,661,054 (GRCm39) critical splice acceptor site probably null
R4760:Vwf UTSW 6 125,547,567 (GRCm39) missense probably damaging 1.00
R4776:Vwf UTSW 6 125,543,268 (GRCm39) missense possibly damaging 0.53
R4791:Vwf UTSW 6 125,620,326 (GRCm39) missense
R4871:Vwf UTSW 6 125,663,425 (GRCm39) missense probably benign 0.25
R4894:Vwf UTSW 6 125,622,897 (GRCm39) nonsense probably null
R4963:Vwf UTSW 6 125,644,446 (GRCm39) nonsense probably null
R5010:Vwf UTSW 6 125,543,220 (GRCm39) missense probably benign 0.15
R5289:Vwf UTSW 6 125,644,473 (GRCm39) utr 3 prime probably benign
R5512:Vwf UTSW 6 125,650,850 (GRCm39) utr 3 prime probably benign
R5523:Vwf UTSW 6 125,620,005 (GRCm39) missense
R5642:Vwf UTSW 6 125,580,381 (GRCm39) missense
R5860:Vwf UTSW 6 125,656,228 (GRCm39) utr 3 prime probably benign
R5860:Vwf UTSW 6 125,620,053 (GRCm39) missense
R5896:Vwf UTSW 6 125,655,725 (GRCm39) critical splice acceptor site probably null
R5926:Vwf UTSW 6 125,581,137 (GRCm39) missense probably damaging 1.00
R5976:Vwf UTSW 6 125,580,426 (GRCm39) missense
R6053:Vwf UTSW 6 125,577,628 (GRCm39) missense probably benign 0.21
R6151:Vwf UTSW 6 125,634,028 (GRCm39) missense unknown
R6179:Vwf UTSW 6 125,626,252 (GRCm39) missense unknown
R6181:Vwf UTSW 6 125,543,109 (GRCm39) missense probably damaging 0.98
R6234:Vwf UTSW 6 125,634,128 (GRCm39) missense unknown
R6360:Vwf UTSW 6 125,660,489 (GRCm39) missense probably benign 0.13
R6412:Vwf UTSW 6 125,656,279 (GRCm39) missense probably benign 0.00
R6464:Vwf UTSW 6 125,616,363 (GRCm39) critical splice donor site probably null
R6522:Vwf UTSW 6 125,639,926 (GRCm39) critical splice acceptor site probably null
R6766:Vwf UTSW 6 125,616,339 (GRCm39) missense unknown
R6856:Vwf UTSW 6 125,619,113 (GRCm39) nonsense probably null
R6877:Vwf UTSW 6 125,634,164 (GRCm39) missense possibly damaging 0.48
R6896:Vwf UTSW 6 125,543,157 (GRCm39) missense probably damaging 1.00
R7113:Vwf UTSW 6 125,632,007 (GRCm39) missense
R7287:Vwf UTSW 6 125,614,430 (GRCm39) missense
R7359:Vwf UTSW 6 125,543,220 (GRCm39) missense
R7509:Vwf UTSW 6 125,619,132 (GRCm39) missense
R7519:Vwf UTSW 6 125,644,506 (GRCm39) missense
R7545:Vwf UTSW 6 125,591,060 (GRCm39) missense
R7549:Vwf UTSW 6 125,603,230 (GRCm39) missense
R7593:Vwf UTSW 6 125,624,731 (GRCm39) missense
R7635:Vwf UTSW 6 125,659,697 (GRCm39) missense
R7793:Vwf UTSW 6 125,663,483 (GRCm39) missense
R7802:Vwf UTSW 6 125,643,640 (GRCm39) missense
R7824:Vwf UTSW 6 125,635,778 (GRCm39) missense
R7849:Vwf UTSW 6 125,633,766 (GRCm39) missense
R7900:Vwf UTSW 6 125,605,439 (GRCm39) critical splice donor site probably null
R7919:Vwf UTSW 6 125,624,822 (GRCm39) missense
R7966:Vwf UTSW 6 125,616,304 (GRCm39) nonsense probably null
R8101:Vwf UTSW 6 125,547,522 (GRCm39) nonsense probably null
R8162:Vwf UTSW 6 125,622,799 (GRCm39) splice site probably null
R8345:Vwf UTSW 6 125,656,265 (GRCm39) missense
R8853:Vwf UTSW 6 125,634,227 (GRCm39) missense
R9027:Vwf UTSW 6 125,643,626 (GRCm39) missense
R9065:Vwf UTSW 6 125,623,262 (GRCm39) missense
R9068:Vwf UTSW 6 125,625,792 (GRCm39) unclassified probably benign
R9128:Vwf UTSW 6 125,619,693 (GRCm39) missense
R9136:Vwf UTSW 6 125,576,356 (GRCm39) splice site probably benign
R9164:Vwf UTSW 6 125,542,806 (GRCm39) missense
R9177:Vwf UTSW 6 125,581,254 (GRCm39) missense
R9334:Vwf UTSW 6 125,654,909 (GRCm39) missense
R9508:Vwf UTSW 6 125,532,471 (GRCm39) missense
R9553:Vwf UTSW 6 125,577,662 (GRCm39) missense
R9660:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9706:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9708:Vwf UTSW 6 125,634,053 (GRCm39) missense
R9712:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9714:Vwf UTSW 6 125,601,536 (GRCm39) missense
R9728:Vwf UTSW 6 125,568,670 (GRCm39) missense possibly damaging 0.61
R9758:Vwf UTSW 6 125,603,230 (GRCm39) missense
X0021:Vwf UTSW 6 125,623,294 (GRCm39) missense probably damaging 1.00
X0065:Vwf UTSW 6 125,580,396 (GRCm39) missense probably null 0.05
Z1176:Vwf UTSW 6 125,580,271 (GRCm39) splice site probably null
Z1176:Vwf UTSW 6 125,568,194 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GAAGATGCTCTTTCAGGGCAAC -3'
(R):5'- GAGGGTAAAACACAAGTAGCCTTC -3'

Sequencing Primer
(F):5'- TCTTTCAGGGCAACGCTGG -3'
(R):5'- GGTAAAACACAAGTAGCCTTCATCTC -3'
Posted On 2014-06-23