Incidental Mutation 'R1809:Vwf'
ID 203691
Institutional Source Beutler Lab
Gene Symbol Vwf
Ensembl Gene ENSMUSG00000001930
Gene Name Von Willebrand factor
Synonyms 6820430P06Rik, B130011O06Rik
MMRRC Submission 039838-MU
Accession Numbers

Genbank: NM_011708; MGI: 98941

Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock # R1809 (G1)
Quality Score 191
Status Validated
Chromosome 6
Chromosomal Location 125546774-125686679 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 125590175 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100941] [ENSMUST00000112253] [ENSMUST00000112254]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000100941
SMART Domains Protein: ENSMUSP00000098502
Gene: ENSMUSG00000001930

DomainStartEndE-ValueType
VWD 38 196 3.43e-35 SMART
C8 236 310 1.11e-21 SMART
Pfam:TIL 313 366 2.8e-15 PFAM
Blast:VWC 368 404 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112253
SMART Domains Protein: ENSMUSP00000107872
Gene: ENSMUSG00000001930

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 2.7e-15 PFAM
Blast:VWC 353 389 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112254
SMART Domains Protein: ENSMUSP00000107873
Gene: ENSMUSG00000001930

DomainStartEndE-ValueType
VWD 23 181 3.43e-35 SMART
C8 221 295 1.11e-21 SMART
Pfam:TIL 298 351 6.9e-15 PFAM
VWC 353 413 8.71e-1 SMART
VWD 380 543 2.93e-52 SMART
C8 580 652 3.82e-25 SMART
Pfam:TIL 655 710 4.1e-14 PFAM
EGF_like 790 825 4.37e1 SMART
VWC 832 901 3.29e-3 SMART
VWD 859 1015 5.15e-39 SMART
C8 1056 1130 1.01e-33 SMART
Pfam:TIL 1144 1199 1.3e-9 PFAM
VWA 1278 1461 1.81e-20 SMART
low complexity region 1464 1477 N/A INTRINSIC
VWA 1499 1672 8.43e-39 SMART
VWA 1692 1875 2.83e-31 SMART
VWC 1882 1949 2.99e0 SMART
VWD 1941 2104 5.03e-42 SMART
C8 2135 2203 1.29e-13 SMART
Pfam:TIL 2206 2257 8.3e-8 PFAM
VWC 2260 2328 3.16e-16 SMART
low complexity region 2417 2428 N/A INTRINSIC
VWC 2434 2497 2.61e-17 SMART
VWC 2513 2577 3.37e0 SMART
VWC 2585 2647 2.55e-11 SMART
CT 2730 2815 1.37e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150548
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (107/111)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein involved in hemostasis. The encoded preproprotein is proteolytically processed following assembly into large multimeric complexes. These complexes function in the adhesion of platelets to sites of vascular injury and the transport of various proteins in the blood. Mutations in this gene result in von Willebrand disease, an inherited bleeding disorder. An unprocessed pseudogene has been found on chromosome 22. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mutants exhibit hemostatic and thrombotic defects similar to human von Willebrand disease. Mutants have prolonged bleeding time, newborns occasionally show fatal intra-abdominal bleeding and some adults have detectable fecal occult blood. [provided by MGI curators]
Allele List at MGI

All alleles(33) : Targeted, knock-out(1) Gene trapped(32)

Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930502E18Rik A G X: 53,733,749 E99G probably benign Het
9130409I23Rik T C 1: 181,059,687 I279T probably damaging Het
Ablim2 A G 5: 35,843,270 probably benign Het
Adamts20 C T 15: 94,341,087 S750N probably damaging Het
Adh6a G A 3: 138,330,961 R370H possibly damaging Het
Akr1b7 A G 6: 34,419,111 N183D probably damaging Het
Aktip A T 8: 91,129,720 I43N probably damaging Het
Ankrd26 A T 6: 118,525,922 probably benign Het
Ano9 G A 7: 141,108,804 T144I possibly damaging Het
Anpep G T 7: 79,841,823 D143E probably benign Het
Aox2 C A 1: 58,294,325 Q234K probably benign Het
Ap1g1 C G 8: 109,833,182 probably benign Het
Arhgef4 G A 1: 34,810,555 probably null Het
Armc4 T A 18: 7,211,630 Y748F probably benign Het
Arsj A G 3: 126,438,295 Y230C possibly damaging Het
Asmt C T X: 170,675,745 probably benign Het
Astl A T 2: 127,345,485 K72N probably damaging Het
Atp2b2 G A 6: 113,803,743 probably benign Het
Baiap2l1 A C 5: 144,324,555 probably null Het
C7 A T 15: 5,034,339 N193K probably damaging Het
Cacna2d4 G T 6: 119,270,824 R362L probably damaging Het
Cct4 T A 11: 22,997,615 D189E probably benign Het
Cd300lg G A 11: 102,043,112 G62S probably benign Het
Cdk14 T A 5: 5,010,901 M307L probably damaging Het
Cfi G A 3: 129,873,119 probably null Het
Clec2g G T 6: 128,980,310 probably null Het
Cntnap2 T C 6: 46,988,675 S807P probably damaging Het
Col6a3 T A 1: 90,827,949 H206L probably damaging Het
Cyp2c23 A T 19: 44,021,558 probably benign Het
Dlec1 T C 9: 119,136,699 V1058A probably benign Het
Dpp9 A G 17: 56,199,038 Y454H probably damaging Het
Drosha G A 15: 12,890,112 G920R probably null Het
Duox2 A G 2: 122,283,897 S1142P possibly damaging Het
Fam13a C T 6: 58,965,060 probably null Het
Filip1l A G 16: 57,506,660 R18G probably benign Het
Foxa1 A G 12: 57,542,741 V231A probably damaging Het
Gm11756 A G 4: 73,917,517 F237L probably benign Het
Gm4787 A T 12: 81,378,529 M285K possibly damaging Het
Gm5084 T A 13: 60,212,506 noncoding transcript Het
Gm6788 G A 19: 28,763,186 noncoding transcript Het
Gm9922 G T 14: 101,729,405 probably benign Het
Gtf3c4 A T 2: 28,833,976 Y440* probably null Het
Helq A G 5: 100,773,954 S795P probably damaging Het
Helz T A 11: 107,599,171 S151T possibly damaging Het
Irgm1 T C 11: 48,866,613 T124A probably benign Het
Itgam C T 7: 128,070,937 P134S possibly damaging Het
Kdm6a T C X: 18,236,684 Y217H probably benign Het
Kif6 T C 17: 49,901,784 L744P probably benign Het
Kmt2c C T 5: 25,284,192 R1203H probably damaging Het
Ksr2 A G 5: 117,555,470 T328A probably damaging Het
Lig1 T C 7: 13,300,355 probably benign Het
Lpar3 G A 3: 146,240,548 probably benign Het
Lrrk2 T C 15: 91,699,892 F285S possibly damaging Het
March7 A G 2: 60,232,293 D148G probably benign Het
Mcee T C 7: 64,400,301 L60S probably damaging Het
Mob2 A G 7: 142,016,374 I81T probably damaging Het
Mphosph8 T A 14: 56,672,452 D87E probably damaging Het
Myo1g T C 11: 6,512,283 T560A probably benign Het
Nagk C T 6: 83,797,187 T42I probably benign Het
Naip1 G T 13: 100,426,239 T806K probably benign Het
Ncor2 A G 5: 125,118,793 probably benign Het
Ocln G T 13: 100,511,459 Y401* probably null Het
Olfr922 G A 9: 38,816,147 V215I probably benign Het
Oma1 T A 4: 103,325,177 N292K probably damaging Het
Ovch2 T A 7: 107,790,205 probably null Het
Pcdhb16 T C 18: 37,478,388 F134L probably damaging Het
Pipox A T 11: 77,881,534 Y337N probably benign Het
Polr3b A G 10: 84,693,001 D763G probably damaging Het
Pygo1 T A 9: 72,944,796 N88K probably damaging Het
Rab3gap1 T C 1: 127,934,514 M674T probably damaging Het
Rbm25 T C 12: 83,672,727 probably benign Het
Rbm26 C T 14: 105,117,106 probably benign Het
Rbms2 G A 10: 128,138,186 T187I possibly damaging Het
Rnase11 T A 14: 51,049,727 R123S probably benign Het
Rngtt A G 4: 33,443,614 N485D probably benign Het
Rp1l1 A T 14: 64,027,966 M334L probably benign Het
Rps9 T A 7: 3,704,727 L56Q probably damaging Het
Saysd1 C A 14: 20,083,102 probably benign Het
Sema4d C T 13: 51,713,691 probably null Het
Shisa5 A T 9: 109,040,930 D34V probably damaging Het
Skil A G 3: 31,117,506 D547G probably damaging Het
Slc2a5 T A 4: 150,143,057 F444L probably damaging Het
Slc9b2 T G 3: 135,317,131 C10G possibly damaging Het
Sorcs2 G T 5: 36,229,220 probably benign Het
Stk17b T G 1: 53,765,981 K140N possibly damaging Het
Stradb T A 1: 58,994,390 L404Q possibly damaging Het
Synj2 T C 17: 6,026,551 M432T possibly damaging Het
Tanc1 G T 2: 59,800,097 R800L probably damaging Het
Tenm4 A G 7: 96,873,780 M1473V probably benign Het
Tesc A G 5: 118,061,602 I190V probably benign Het
Tex15 T C 8: 33,574,234 F1231L probably benign Het
Thrsp T C 7: 97,417,125 I127V probably benign Het
Tlr6 A T 5: 64,953,712 C617* probably null Het
Trank1 A T 9: 111,392,825 I2877F probably benign Het
Ucp1 T C 8: 83,297,867 S274P probably damaging Het
Ucp2 T A 7: 100,498,399 V195E probably damaging Het
Vars2 T C 17: 35,662,216 T394A probably damaging Het
Vmn1r1 A G 1: 182,157,806 V98A possibly damaging Het
Vmn1r225 A G 17: 20,502,656 I120V probably benign Het
Vmn2r102 A T 17: 19,677,619 M299L probably benign Het
Vmn2r25 A G 6: 123,825,378 V522A probably benign Het
Vmn2r70 T C 7: 85,565,922 I135V probably benign Het
Zcchc11 T A 4: 108,549,355 H1373Q probably damaging Het
Zfp446 T C 7: 12,979,121 F29L probably damaging Het
Other mutations in Vwf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Vwf APN 6 125658872 missense unknown
IGL00561:Vwf APN 6 125642721 missense possibly damaging 0.88
IGL01104:Vwf APN 6 125683556 missense probably damaging 1.00
IGL01404:Vwf APN 6 125677970 missense probably damaging 1.00
IGL01539:Vwf APN 6 125590262 missense possibly damaging 0.85
IGL01550:Vwf APN 6 125679289 missense probably benign 0.00
IGL01563:Vwf APN 6 125591165 missense probably damaging 1.00
IGL01637:Vwf APN 6 125645736 missense probably damaging 1.00
IGL01720:Vwf APN 6 125642835 missense possibly damaging 0.69
IGL01834:Vwf APN 6 125590170 splice site probably benign
IGL02103:Vwf APN 6 125646355 missense probably damaging 1.00
IGL02120:Vwf APN 6 125616034 missense probably benign 0.26
IGL02174:Vwf APN 6 125555395 missense probably damaging 1.00
IGL02203:Vwf APN 6 125642406 missense probably damaging 1.00
IGL02420:Vwf APN 6 125677916 missense probably benign 0.00
IGL02723:Vwf APN 6 125642930 missense possibly damaging 0.85
IGL02818:Vwf APN 6 125663548 missense probably benign
IGL02931:Vwf APN 6 125615968 missense possibly damaging 0.68
IGL03015:Vwf APN 6 125684138 splice site probably benign
IGL03038:Vwf APN 6 125604157 missense possibly damaging 0.92
IGL03060:Vwf APN 6 125663560 missense probably damaging 1.00
IGL03114:Vwf APN 6 125599363 nonsense probably null
IGL03266:Vwf APN 6 125678077 splice site probably benign
gingerman UTSW 6 125662963 critical splice acceptor site probably null
R0605_vwf_644 UTSW 6 125685837 missense probably benign 0.02
R1575_Vwf_091 UTSW 6 125663571 nonsense probably null
R1628_Vwf_608 UTSW 6 125647738 unclassified probably benign
R1669_Vwf_448 UTSW 6 125647906 missense possibly damaging 0.92
R1833_Vwf_948 UTSW 6 125642037 missense probably benign 0.14
R2130_vwf_946 UTSW 6 125657057 missense probably damaging 1.00
R6360_Vwf_065 UTSW 6 125683526 missense probably benign 0.13
R7900_Vwf_938 UTSW 6 125628476 critical splice donor site probably null
Russiahouse UTSW 6 125639341 nonsense probably null
B5639:Vwf UTSW 6 125642984 missense probably damaging 1.00
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0025:Vwf UTSW 6 125682812 missense probably benign 0.05
R0087:Vwf UTSW 6 125645954 missense probably benign 0.03
R0194:Vwf UTSW 6 125643297 missense probably benign
R0206:Vwf UTSW 6 125637456 missense probably damaging 1.00
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0233:Vwf UTSW 6 125686510 missense possibly damaging 0.91
R0390:Vwf UTSW 6 125626361 nonsense probably null
R0427:Vwf UTSW 6 125673939 missense probably benign
R0437:Vwf UTSW 6 125566318 missense probably damaging 1.00
R0470:Vwf UTSW 6 125628428 missense possibly damaging 0.70
R0499:Vwf UTSW 6 125638114 missense probably benign 0.10
R0554:Vwf UTSW 6 125642781 missense probably benign 0.13
R0605:Vwf UTSW 6 125685837 missense probably benign 0.02
R0711:Vwf UTSW 6 125626271 missense probably benign 0.01
R0723:Vwf UTSW 6 125566262 missense probably benign 0.01
R0973:Vwf UTSW 6 125643006 missense probably damaging 1.00
R1054:Vwf UTSW 6 125590227 missense probably damaging 1.00
R1115:Vwf UTSW 6 125655065 missense unknown
R1156:Vwf UTSW 6 125637488 missense probably damaging 1.00
R1191:Vwf UTSW 6 125599252 missense probably damaging 1.00
R1240:Vwf UTSW 6 125603308 splice site probably null
R1398:Vwf UTSW 6 125603457 missense probably benign 0.02
R1435:Vwf UTSW 6 125642249 nonsense probably null
R1528:Vwf UTSW 6 125608291 missense possibly damaging 0.69
R1575:Vwf UTSW 6 125655251 missense unknown
R1575:Vwf UTSW 6 125663571 nonsense probably null
R1628:Vwf UTSW 6 125647738 unclassified probably benign
R1669:Vwf UTSW 6 125647906 missense possibly damaging 0.92
R1699:Vwf UTSW 6 125643069 missense probably damaging 1.00
R1699:Vwf UTSW 6 125685900 missense possibly damaging 0.74
R1725:Vwf UTSW 6 125646282 missense probably benign 0.05
R1742:Vwf UTSW 6 125667550 missense probably benign 0.02
R1833:Vwf UTSW 6 125642037 missense probably benign 0.14
R1866:Vwf UTSW 6 125667529 missense possibly damaging 0.62
R1870:Vwf UTSW 6 125642939 missense probably damaging 1.00
R1874:Vwf UTSW 6 125628372 missense probably benign 0.00
R1941:Vwf UTSW 6 125639279 missense possibly damaging 0.64
R2061:Vwf UTSW 6 125591188 missense probably damaging 0.98
R2103:Vwf UTSW 6 125646330 missense probably benign 0.31
R2104:Vwf UTSW 6 125646330 missense probably benign 0.31
R2130:Vwf UTSW 6 125657057 missense probably damaging 1.00
R2159:Vwf UTSW 6 125626341 missense probably damaging 0.99
R2178:Vwf UTSW 6 125642132 missense possibly damaging 0.90
R2656:Vwf UTSW 6 125555361 missense probably benign 0.00
R2913:Vwf UTSW 6 125685846 missense probably benign 0.08
R2917:Vwf UTSW 6 125608143 missense probably benign 0.07
R3726:Vwf UTSW 6 125677948 utr 3 prime probably benign
R3735:Vwf UTSW 6 125588613 missense probably damaging 1.00
R3774:Vwf UTSW 6 125649099 splice site probably null
R3934:Vwf UTSW 6 125555499 missense probably damaging 1.00
R4291:Vwf UTSW 6 125642322 missense probably damaging 1.00
R4384:Vwf UTSW 6 125655116 missense unknown
R4743:Vwf UTSW 6 125684091 critical splice acceptor site probably null
R4760:Vwf UTSW 6 125570604 missense probably damaging 1.00
R4776:Vwf UTSW 6 125566305 missense possibly damaging 0.53
R4791:Vwf UTSW 6 125643363 missense
R4871:Vwf UTSW 6 125686462 missense probably benign 0.25
R4894:Vwf UTSW 6 125645934 nonsense probably null
R4963:Vwf UTSW 6 125667483 nonsense probably null
R5010:Vwf UTSW 6 125566257 missense probably benign 0.15
R5289:Vwf UTSW 6 125667510 utr 3 prime probably benign
R5512:Vwf UTSW 6 125673887 utr 3 prime probably benign
R5523:Vwf UTSW 6 125643042 missense
R5642:Vwf UTSW 6 125603418 missense
R5860:Vwf UTSW 6 125643090 missense
R5860:Vwf UTSW 6 125679265 utr 3 prime probably benign
R5896:Vwf UTSW 6 125678762 critical splice acceptor site probably null
R5926:Vwf UTSW 6 125604174 missense probably damaging 1.00
R5976:Vwf UTSW 6 125603463 missense
R6053:Vwf UTSW 6 125600665 missense probably benign 0.21
R6151:Vwf UTSW 6 125657065 missense unknown
R6179:Vwf UTSW 6 125649289 missense unknown
R6181:Vwf UTSW 6 125566146 missense probably damaging 0.98
R6234:Vwf UTSW 6 125657165 missense unknown
R6360:Vwf UTSW 6 125683526 missense probably benign 0.13
R6412:Vwf UTSW 6 125679316 missense probably benign 0.00
R6464:Vwf UTSW 6 125639400 critical splice donor site probably null
R6522:Vwf UTSW 6 125662963 critical splice acceptor site probably null
R6766:Vwf UTSW 6 125639376 missense unknown
R6856:Vwf UTSW 6 125642150 nonsense probably null
R6877:Vwf UTSW 6 125657201 missense possibly damaging 0.48
R6896:Vwf UTSW 6 125566194 missense probably damaging 1.00
R7113:Vwf UTSW 6 125655044 missense
R7287:Vwf UTSW 6 125637467 missense
R7359:Vwf UTSW 6 125566257 missense
R7509:Vwf UTSW 6 125642169 missense
R7519:Vwf UTSW 6 125667543 missense
R7545:Vwf UTSW 6 125614097 missense
R7549:Vwf UTSW 6 125626267 missense
R7593:Vwf UTSW 6 125647768 missense
R7635:Vwf UTSW 6 125682734 missense
R7793:Vwf UTSW 6 125686520 missense
R7802:Vwf UTSW 6 125666677 missense
R7824:Vwf UTSW 6 125658815 missense
R7849:Vwf UTSW 6 125656803 missense
R7900:Vwf UTSW 6 125628476 critical splice donor site probably null
R7919:Vwf UTSW 6 125647859 missense
R7966:Vwf UTSW 6 125639341 nonsense probably null
R8101:Vwf UTSW 6 125570559 nonsense probably null
R8162:Vwf UTSW 6 125645836 splice site probably null
R8345:Vwf UTSW 6 125679302 missense
R8853:Vwf UTSW 6 125657264 missense
R9027:Vwf UTSW 6 125666663 missense
R9065:Vwf UTSW 6 125646299 missense
R9068:Vwf UTSW 6 125648829 unclassified probably benign
R9128:Vwf UTSW 6 125642730 missense
R9164:Vwf UTSW 6 125565843 missense
R9177:Vwf UTSW 6 125604291 missense
R9334:Vwf UTSW 6 125677946 missense
X0021:Vwf UTSW 6 125646331 missense probably damaging 1.00
X0065:Vwf UTSW 6 125603433 missense probably null 0.05
Z1176:Vwf UTSW 6 125591231 missense
Z1176:Vwf UTSW 6 125603308 splice site probably null
Predicted Primers PCR Primer
(F):5'- GAAGATGCTCTTTCAGGGCAAC -3'
(R):5'- GAGGGTAAAACACAAGTAGCCTTC -3'

Sequencing Primer
(F):5'- TCTTTCAGGGCAACGCTGG -3'
(R):5'- GGTAAAACACAAGTAGCCTTCATCTC -3'
Posted On 2014-06-23