Incidental Mutation 'R0110:Alms1'
ID 20372
Institutional Source Beutler Lab
Gene Symbol Alms1
Ensembl Gene ENSMUSG00000063810
Gene Name ALMS1, centrosome and basal body associated
Synonyms
MMRRC Submission 038396-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0110 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 6
Chromosomal Location 85587531-85702753 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 85620369 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1195 (R1195*)
Ref Sequence ENSEMBL: ENSMUSP00000148796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000072018
AA Change: R726*
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: R726*

DomainStartEndE-ValueType
coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213058
AA Change: R1195*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,506 (GRCm38) probably benign Het
4933408B17Rik A T 18: 34,596,151 (GRCm38) D42E probably damaging Het
Abcg3 A G 5: 104,977,616 (GRCm38) I67T probably damaging Het
Adam10 T A 9: 70,748,248 (GRCm38) W333R probably damaging Het
Ahnak C T 19: 9,018,232 (GRCm38) R5627* probably null Het
AI606181 A C 19: 41,593,731 (GRCm38) K113N unknown Het
Ankrd11 T C 8: 122,892,175 (GRCm38) D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 (GRCm38) I334N possibly damaging Het
Arpc1b T A 5: 145,127,715 (GRCm38) W361R probably damaging Het
Baiap2l1 T C 5: 144,275,891 (GRCm38) Y438C probably damaging Het
Ccdc110 T A 8: 45,935,157 (GRCm38) N50K probably benign Het
Cdhr1 T C 14: 37,080,676 (GRCm38) Y610C probably damaging Het
Celsr3 G A 9: 108,827,005 (GRCm38) C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 (GRCm38) Y676N probably damaging Het
Cntln C T 4: 85,096,757 (GRCm38) T1095I probably damaging Het
Cog2 T C 8: 124,529,058 (GRCm38) probably null Het
Col11a1 A T 3: 114,105,456 (GRCm38) probably benign Het
Cpe T A 8: 64,611,467 (GRCm38) I233F probably damaging Het
Dcaf11 T C 14: 55,569,080 (GRCm38) V446A probably damaging Het
Defa34 A G 8: 21,665,972 (GRCm38) probably null Het
Dnah12 A G 14: 26,798,899 (GRCm38) R1892G probably damaging Het
Dock4 A G 12: 40,621,312 (GRCm38) probably benign Het
Dync1h1 C A 12: 110,639,944 (GRCm38) Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 (GRCm38) D759E probably damaging Het
Epyc A G 10: 97,649,763 (GRCm38) T22A probably benign Het
Fam227b T A 2: 126,100,921 (GRCm38) S319C probably damaging Het
Fam83a C A 15: 58,009,926 (GRCm38) Q384K probably benign Het
Fam83b G T 9: 76,492,826 (GRCm38) L332I possibly damaging Het
Gal3st2c C T 1: 94,009,497 (GRCm38) P388L probably benign Het
Ggn C T 7: 29,171,296 (GRCm38) P47S probably damaging Het
Gli3 T G 13: 15,724,785 (GRCm38) L919R probably damaging Het
Gm5134 C A 10: 75,974,245 (GRCm38) T120N probably benign Het
Gm5415 T A 1: 32,545,875 (GRCm38) N318I possibly damaging Het
Gm8251 C A 1: 44,059,224 (GRCm38) V905F probably benign Het
Gmip C T 8: 69,815,609 (GRCm38) probably benign Het
Gpr39 C T 1: 125,677,500 (GRCm38) T55M probably damaging Het
Grk4 A G 5: 34,716,213 (GRCm38) T208A probably damaging Het
Gsdme C A 6: 50,246,127 (GRCm38) probably benign Het
Gucy2e T C 11: 69,235,576 (GRCm38) D326G probably benign Het
Hadhb T C 5: 30,169,485 (GRCm38) probably benign Het
Hectd4 T A 5: 121,281,896 (GRCm38) Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 (GRCm38) E1319K possibly damaging Het
Ikbkb A T 8: 22,671,635 (GRCm38) C412* probably null Het
Itpa A T 2: 130,679,418 (GRCm38) probably benign Het
Klhl10 A G 11: 100,456,932 (GRCm38) T605A probably benign Het
Krt74 T C 15: 101,763,316 (GRCm38) noncoding transcript Het
Krt81 C A 15: 101,463,627 (GRCm38) R24L possibly damaging Het
Lap3 T C 5: 45,495,290 (GRCm38) probably benign Het
Lrrc10 T A 10: 117,045,790 (GRCm38) L123Q probably damaging Het
Map3k6 T C 4: 133,243,794 (GRCm38) L273P probably damaging Het
Mbl1 A G 14: 41,158,749 (GRCm38) N198S probably damaging Het
Mcf2l A G 8: 12,997,337 (GRCm38) D233G probably damaging Het
Mdga2 T C 12: 66,470,926 (GRCm38) K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 (GRCm38) N3524S probably benign Het
Mrc1 T A 2: 14,238,542 (GRCm38) probably benign Het
Msto1 A G 3: 88,911,541 (GRCm38) L269P probably benign Het
Mtcl1 C T 17: 66,358,114 (GRCm38) E1149K possibly damaging Het
Naca C T 10: 128,044,790 (GRCm38) A1897V probably benign Het
Ncapg T C 5: 45,693,147 (GRCm38) probably benign Het
Neb A T 2: 52,290,743 (GRCm38) probably benign Het
Olfr467 T C 7: 107,814,688 (GRCm38) Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 (GRCm38) Y102C probably benign Het
Olfr944 G A 9: 39,217,728 (GRCm38) V124I possibly damaging Het
Parp2 T A 14: 50,819,673 (GRCm38) Y361N probably damaging Het
Parp3 A G 9: 106,471,796 (GRCm38) F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 (GRCm38) N296Y probably damaging Het
Pcf11 G A 7: 92,657,831 (GRCm38) P1043L probably damaging Het
Pdzrn3 A T 6: 101,151,053 (GRCm38) I884N probably damaging Het
Phf24 G T 4: 42,933,761 (GRCm38) V48L possibly damaging Het
Pla2g4a T A 1: 149,840,647 (GRCm38) M688L possibly damaging Het
Plcl2 T C 17: 50,607,982 (GRCm38) L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 (GRCm38) F51Y possibly damaging Het
Prmt1 A G 7: 44,978,801 (GRCm38) probably benign Het
Proc G A 18: 32,125,118 (GRCm38) T258I probably benign Het
Prom2 T G 2: 127,531,113 (GRCm38) S679R possibly damaging Het
Psen2 T C 1: 180,238,914 (GRCm38) T153A probably damaging Het
Rem2 T C 14: 54,476,297 (GRCm38) probably benign Het
Rin2 A G 2: 145,861,033 (GRCm38) K550E probably benign Het
Rtn4 T A 11: 29,733,849 (GRCm38) probably benign Het
Ssh1 A T 5: 113,946,705 (GRCm38) D448E probably benign Het
Ssmem1 A T 6: 30,519,548 (GRCm38) probably null Het
Stam2 A T 2: 52,719,986 (GRCm38) probably benign Het
Syne1 A G 10: 5,367,600 (GRCm38) L498P probably damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 (GRCm38) probably null Het
Taf6l G T 19: 8,778,521 (GRCm38) H254Q probably benign Het
Tas2r123 T C 6: 132,847,332 (GRCm38) V64A probably benign Het
Tnnc1 A G 14: 31,211,408 (GRCm38) D149G probably damaging Het
Tpp2 A G 1: 43,999,693 (GRCm38) D1133G probably damaging Het
Tpp2 T A 1: 43,978,504 (GRCm38) V756E probably benign Het
Traf3ip3 T A 1: 193,178,231 (GRCm38) probably null Het
Tsen15 A G 1: 152,371,797 (GRCm38) V148A probably damaging Het
Ttn T A 2: 76,864,328 (GRCm38) probably benign Het
Ube2u A G 4: 100,486,673 (GRCm38) I90V probably benign Het
Unc79 T A 12: 103,079,070 (GRCm38) probably null Het
Usp47 T C 7: 112,056,580 (GRCm38) S155P possibly damaging Het
Wdr41 T C 13: 95,018,111 (GRCm38) probably benign Het
Zfp217 C T 2: 170,115,462 (GRCm38) A539T probably benign Het
Zfp423 A G 8: 87,782,259 (GRCm38) S486P possibly damaging Het
Zfp628 A T 7: 4,919,733 (GRCm38) Q318L probably benign Het
Other mutations in Alms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85,677,964 (GRCm38) missense probably damaging 1.00
IGL00331:Alms1 APN 6 85,641,371 (GRCm38) missense possibly damaging 0.94
IGL00658:Alms1 APN 6 85,628,961 (GRCm38) missense probably damaging 1.00
IGL00835:Alms1 APN 6 85,622,134 (GRCm38) missense probably damaging 1.00
IGL00930:Alms1 APN 6 85,601,310 (GRCm38) missense probably damaging 0.98
IGL01446:Alms1 APN 6 85,696,701 (GRCm38) missense probably damaging 1.00
IGL01448:Alms1 APN 6 85,677,899 (GRCm38) missense possibly damaging 0.93
IGL01563:Alms1 APN 6 85,627,983 (GRCm38) missense probably damaging 1.00
IGL01632:Alms1 APN 6 85,627,946 (GRCm38) missense probably benign 0.07
IGL01651:Alms1 APN 6 85,656,476 (GRCm38) missense probably benign 0.05
IGL01670:Alms1 APN 6 85,678,150 (GRCm38) missense probably benign 0.00
IGL01716:Alms1 APN 6 85,628,094 (GRCm38) missense probably benign 0.01
IGL01719:Alms1 APN 6 85,628,094 (GRCm38) missense probably benign 0.01
IGL01720:Alms1 APN 6 85,628,094 (GRCm38) missense probably benign 0.01
IGL01723:Alms1 APN 6 85,628,094 (GRCm38) missense probably benign 0.01
IGL01877:Alms1 APN 6 85,622,411 (GRCm38) missense possibly damaging 0.55
IGL01919:Alms1 APN 6 85,628,004 (GRCm38) missense possibly damaging 0.77
IGL01976:Alms1 APN 6 85,622,665 (GRCm38) missense possibly damaging 0.73
IGL02003:Alms1 APN 6 85,622,223 (GRCm38) missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85,628,823 (GRCm38) missense probably benign 0.12
IGL02070:Alms1 APN 6 85,651,403 (GRCm38) missense possibly damaging 0.74
IGL02079:Alms1 APN 6 85,628,634 (GRCm38) missense probably damaging 0.98
IGL02081:Alms1 APN 6 85,620,303 (GRCm38) missense possibly damaging 0.55
IGL02379:Alms1 APN 6 85,629,633 (GRCm38) missense probably damaging 0.98
IGL02412:Alms1 APN 6 85,628,872 (GRCm38) missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85,599,967 (GRCm38) missense probably benign
IGL02636:Alms1 APN 6 85,628,654 (GRCm38) missense probably benign 0.28
IGL02702:Alms1 APN 6 85,599,849 (GRCm38) missense probably benign 0.12
IGL02815:Alms1 APN 6 85,667,957 (GRCm38) critical splice donor site probably null
IGL02926:Alms1 APN 6 85,641,450 (GRCm38) missense probably damaging 1.00
IGL02945:Alms1 APN 6 85,620,933 (GRCm38) missense probably damaging 0.96
IGL02959:Alms1 APN 6 85,629,052 (GRCm38) nonsense probably null
IGL03124:Alms1 APN 6 85,678,419 (GRCm38) missense probably benign 0.03
IGL03199:Alms1 APN 6 85,622,497 (GRCm38) missense possibly damaging 0.68
IGL03209:Alms1 APN 6 85,599,973 (GRCm38) splice site probably benign
IGL03247:Alms1 APN 6 85,678,597 (GRCm38) missense possibly damaging 0.85
ares UTSW 6 85,621,275 (GRCm38) nonsense probably null
ares2 UTSW 6 85,677,990 (GRCm38) nonsense probably null
butterball UTSW 6 85,696,771 (GRCm38) missense probably damaging 0.99
earthquake UTSW 6 85,628,735 (GRCm38) nonsense probably null
fatty UTSW 6 85,627,934 (GRCm38) nonsense probably null
gut_check UTSW 6 85,620,369 (GRCm38) nonsense probably null
portly UTSW 6 85,619,712 (GRCm38) missense probably benign 0.00
replete UTSW 6 85,629,208 (GRCm38) missense possibly damaging 0.87
PIT4468001:Alms1 UTSW 6 85,624,719 (GRCm38) critical splice donor site probably null
R0003:Alms1 UTSW 6 85,629,210 (GRCm38) missense possibly damaging 0.90
R0095:Alms1 UTSW 6 85,620,253 (GRCm38) missense possibly damaging 0.90
R0114:Alms1 UTSW 6 85,619,803 (GRCm38) missense probably benign 0.00
R0153:Alms1 UTSW 6 85,641,381 (GRCm38) missense possibly damaging 0.94
R0217:Alms1 UTSW 6 85,622,930 (GRCm38) missense probably damaging 0.99
R0328:Alms1 UTSW 6 85,610,814 (GRCm38) splice site probably null
R0410:Alms1 UTSW 6 85,587,803 (GRCm38) missense unknown
R0469:Alms1 UTSW 6 85,620,369 (GRCm38) nonsense probably null
R0491:Alms1 UTSW 6 85,702,600 (GRCm38) missense probably damaging 0.98
R0510:Alms1 UTSW 6 85,620,369 (GRCm38) nonsense probably null
R0522:Alms1 UTSW 6 85,621,615 (GRCm38) missense probably benign
R0525:Alms1 UTSW 6 85,587,760 (GRCm38) missense unknown
R0611:Alms1 UTSW 6 85,678,671 (GRCm38) missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85,623,033 (GRCm38) missense possibly damaging 0.85
R0718:Alms1 UTSW 6 85,621,821 (GRCm38) missense probably benign 0.00
R0831:Alms1 UTSW 6 85,628,520 (GRCm38) missense probably benign 0.00
R1318:Alms1 UTSW 6 85,628,549 (GRCm38) missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85,667,957 (GRCm38) critical splice donor site probably null
R1561:Alms1 UTSW 6 85,629,052 (GRCm38) nonsense probably null
R1648:Alms1 UTSW 6 85,678,402 (GRCm38) missense probably damaging 0.99
R1697:Alms1 UTSW 6 85,622,454 (GRCm38) missense possibly damaging 0.94
R1699:Alms1 UTSW 6 85,622,880 (GRCm38) missense possibly damaging 0.46
R1715:Alms1 UTSW 6 85,629,052 (GRCm38) nonsense probably null
R1723:Alms1 UTSW 6 85,628,753 (GRCm38) missense probably damaging 1.00
R1734:Alms1 UTSW 6 85,641,550 (GRCm38) critical splice donor site probably null
R1758:Alms1 UTSW 6 85,628,505 (GRCm38) missense probably damaging 0.99
R1804:Alms1 UTSW 6 85,621,275 (GRCm38) nonsense probably null
R1835:Alms1 UTSW 6 85,678,503 (GRCm38) missense possibly damaging 0.94
R1836:Alms1 UTSW 6 85,678,503 (GRCm38) missense possibly damaging 0.94
R2077:Alms1 UTSW 6 85,622,309 (GRCm38) missense possibly damaging 0.93
R2246:Alms1 UTSW 6 85,622,967 (GRCm38) missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85,619,848 (GRCm38) missense probably damaging 1.00
R2280:Alms1 UTSW 6 85,677,973 (GRCm38) missense probably damaging 0.99
R2516:Alms1 UTSW 6 85,667,963 (GRCm38) splice site probably benign
R2519:Alms1 UTSW 6 85,667,963 (GRCm38) splice site probably benign
R2566:Alms1 UTSW 6 85,622,482 (GRCm38) missense possibly damaging 0.84
R2850:Alms1 UTSW 6 85,667,963 (GRCm38) splice site probably benign
R2850:Alms1 UTSW 6 85,621,299 (GRCm38) missense probably benign 0.00
R2932:Alms1 UTSW 6 85,620,562 (GRCm38) missense possibly damaging 0.89
R2944:Alms1 UTSW 6 85,628,391 (GRCm38) missense probably damaging 1.00
R2980:Alms1 UTSW 6 85,628,835 (GRCm38) missense probably damaging 1.00
R3084:Alms1 UTSW 6 85,678,140 (GRCm38) missense probably benign
R3086:Alms1 UTSW 6 85,678,140 (GRCm38) missense probably benign
R3122:Alms1 UTSW 6 85,667,963 (GRCm38) splice site probably benign
R3404:Alms1 UTSW 6 85,667,963 (GRCm38) splice site probably benign
R3405:Alms1 UTSW 6 85,667,963 (GRCm38) splice site probably benign
R3804:Alms1 UTSW 6 85,619,647 (GRCm38) missense probably damaging 1.00
R3904:Alms1 UTSW 6 85,621,678 (GRCm38) missense probably benign 0.00
R4014:Alms1 UTSW 6 85,678,352 (GRCm38) missense probably benign 0.41
R4056:Alms1 UTSW 6 85,587,803 (GRCm38) missense unknown
R4067:Alms1 UTSW 6 85,621,289 (GRCm38) missense probably damaging 1.00
R4110:Alms1 UTSW 6 85,620,888 (GRCm38) missense probably benign 0.00
R4111:Alms1 UTSW 6 85,620,888 (GRCm38) missense probably benign 0.00
R4112:Alms1 UTSW 6 85,620,888 (GRCm38) missense probably benign 0.00
R4194:Alms1 UTSW 6 85,677,990 (GRCm38) nonsense probably null
R4464:Alms1 UTSW 6 85,620,021 (GRCm38) missense possibly damaging 0.66
R4539:Alms1 UTSW 6 85,620,478 (GRCm38) missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85,624,617 (GRCm38) missense probably benign
R4696:Alms1 UTSW 6 85,620,522 (GRCm38) missense probably damaging 1.00
R4825:Alms1 UTSW 6 85,678,245 (GRCm38) missense probably damaging 0.99
R4921:Alms1 UTSW 6 85,628,546 (GRCm38) missense probably benign 0.13
R5030:Alms1 UTSW 6 85,627,964 (GRCm38) missense probably damaging 0.98
R5051:Alms1 UTSW 6 85,627,934 (GRCm38) nonsense probably null
R5085:Alms1 UTSW 6 85,620,732 (GRCm38) missense possibly damaging 0.55
R5141:Alms1 UTSW 6 85,621,432 (GRCm38) missense probably benign 0.01
R5233:Alms1 UTSW 6 85,656,371 (GRCm38) splice site probably null
R5310:Alms1 UTSW 6 85,615,368 (GRCm38) missense possibly damaging 0.79
R5344:Alms1 UTSW 6 85,696,789 (GRCm38) missense probably benign 0.04
R5394:Alms1 UTSW 6 85,623,088 (GRCm38) missense probably benign 0.01
R5460:Alms1 UTSW 6 85,696,731 (GRCm38) missense probably benign 0.08
R5558:Alms1 UTSW 6 85,641,329 (GRCm38) nonsense probably null
R5650:Alms1 UTSW 6 85,620,271 (GRCm38) missense probably damaging 1.00
R5667:Alms1 UTSW 6 85,696,771 (GRCm38) missense probably damaging 0.99
R5671:Alms1 UTSW 6 85,629,208 (GRCm38) missense possibly damaging 0.87
R5688:Alms1 UTSW 6 85,599,895 (GRCm38) missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85,622,838 (GRCm38) missense probably damaging 0.99
R5892:Alms1 UTSW 6 85,620,903 (GRCm38) missense probably damaging 0.99
R5947:Alms1 UTSW 6 85,619,712 (GRCm38) missense probably benign 0.00
R6031:Alms1 UTSW 6 85,622,955 (GRCm38) missense probably damaging 1.00
R6031:Alms1 UTSW 6 85,622,955 (GRCm38) missense probably damaging 1.00
R6144:Alms1 UTSW 6 85,623,074 (GRCm38) missense probably damaging 0.98
R6258:Alms1 UTSW 6 85,628,735 (GRCm38) nonsense probably null
R6260:Alms1 UTSW 6 85,628,735 (GRCm38) nonsense probably null
R6455:Alms1 UTSW 6 85,696,657 (GRCm38) missense probably damaging 0.99
R6569:Alms1 UTSW 6 85,641,339 (GRCm38) missense probably benign 0.07
R6637:Alms1 UTSW 6 85,619,734 (GRCm38) missense possibly damaging 0.78
R6866:Alms1 UTSW 6 85,621,098 (GRCm38) missense possibly damaging 0.85
R6918:Alms1 UTSW 6 85,622,661 (GRCm38) missense possibly damaging 0.87
R7121:Alms1 UTSW 6 85,624,622 (GRCm38) missense probably damaging 1.00
R7179:Alms1 UTSW 6 85,621,369 (GRCm38) missense probably benign 0.09
R7334:Alms1 UTSW 6 85,641,450 (GRCm38) missense probably damaging 0.99
R7376:Alms1 UTSW 6 85,622,106 (GRCm38) missense probably benign 0.10
R7394:Alms1 UTSW 6 85,622,223 (GRCm38) missense possibly damaging 0.54
R7413:Alms1 UTSW 6 85,628,306 (GRCm38) missense probably benign 0.03
R7511:Alms1 UTSW 6 85,609,425 (GRCm38) missense unknown
R7542:Alms1 UTSW 6 85,629,362 (GRCm38) missense possibly damaging 0.62
R7562:Alms1 UTSW 6 85,620,412 (GRCm38) missense probably damaging 1.00
R7575:Alms1 UTSW 6 85,622,159 (GRCm38) missense possibly damaging 0.49
R7577:Alms1 UTSW 6 85,615,320 (GRCm38) missense probably benign 0.09
R7618:Alms1 UTSW 6 85,678,417 (GRCm38) missense probably benign 0.07
R7653:Alms1 UTSW 6 85,620,595 (GRCm38) missense possibly damaging 0.47
R7672:Alms1 UTSW 6 85,615,351 (GRCm38) missense probably damaging 1.00
R7807:Alms1 UTSW 6 85,622,976 (GRCm38) missense possibly damaging 0.91
R7815:Alms1 UTSW 6 85,615,358 (GRCm38) missense probably benign 0.42
R7849:Alms1 UTSW 6 85,621,497 (GRCm38) missense possibly damaging 0.48
R7944:Alms1 UTSW 6 85,641,380 (GRCm38) missense probably benign 0.03
R7954:Alms1 UTSW 6 85,621,162 (GRCm38) missense probably damaging 0.98
R7971:Alms1 UTSW 6 85,628,679 (GRCm38) missense probably benign
R8048:Alms1 UTSW 6 85,641,334 (GRCm38) missense probably benign 0.13
R8223:Alms1 UTSW 6 85,643,240 (GRCm38) nonsense probably null
R8332:Alms1 UTSW 6 85,620,579 (GRCm38) missense probably benign 0.05
R8374:Alms1 UTSW 6 85,608,991 (GRCm38) missense probably benign 0.41
R8470:Alms1 UTSW 6 85,641,375 (GRCm38) missense probably damaging 0.99
R8755:Alms1 UTSW 6 85,621,574 (GRCm38) missense probably benign 0.01
R8979:Alms1 UTSW 6 85,621,027 (GRCm38) missense probably damaging 0.98
R9044:Alms1 UTSW 6 85,696,753 (GRCm38) missense probably damaging 0.98
R9057:Alms1 UTSW 6 85,609,832 (GRCm38) missense unknown
R9224:Alms1 UTSW 6 85,621,788 (GRCm38) missense possibly damaging 0.69
R9259:Alms1 UTSW 6 85,667,891 (GRCm38) missense possibly damaging 0.94
R9401:Alms1 UTSW 6 85,678,019 (GRCm38) nonsense probably null
R9459:Alms1 UTSW 6 85,627,964 (GRCm38) missense probably damaging 0.98
R9633:Alms1 UTSW 6 85,623,143 (GRCm38) missense probably damaging 0.99
R9716:Alms1 UTSW 6 85,601,252 (GRCm38) missense possibly damaging 0.84
R9730:Alms1 UTSW 6 85,629,438 (GRCm38) missense probably benign 0.00
R9790:Alms1 UTSW 6 85,619,443 (GRCm38) missense probably benign 0.04
R9791:Alms1 UTSW 6 85,619,443 (GRCm38) missense probably benign 0.04
R9802:Alms1 UTSW 6 85,629,238 (GRCm38) missense possibly damaging 0.61
X0013:Alms1 UTSW 6 85,656,455 (GRCm38) missense probably damaging 1.00
X0025:Alms1 UTSW 6 85,620,210 (GRCm38) missense probably damaging 0.96
Z1176:Alms1 UTSW 6 85,678,418 (GRCm38) missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TTTTCTATCAGCAGGGGTTGCCAG -3'
(R):5'- TGCAGATCCTCTTCAGACAGACCAC -3'

Sequencing Primer
(F):5'- TTGCCAGATAGGCATTCAGC -3'
(R):5'- CACCATCTGGCAGGGTTTG -3'
Posted On 2013-04-11