Incidental Mutation 'R1860:Timeless'
ID203821
Institutional Source Beutler Lab
Gene Symbol Timeless
Ensembl Gene ENSMUSG00000039994
Gene Nametimeless circadian clock 1
Synonymstim
MMRRC Submission 039883-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1860 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location128232065-128252941 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128246114 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 536 (K536R)
Ref Sequence ENSEMBL: ENSMUSP00000100879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055539] [ENSMUST00000105242] [ENSMUST00000105243] [ENSMUST00000105244] [ENSMUST00000105245] [ENSMUST00000125289]
Predicted Effect probably benign
Transcript: ENSMUST00000055539
AA Change: K536R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058021
Gene: ENSMUSG00000039994
AA Change: K536R

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.2e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105240
Predicted Effect probably benign
Transcript: ENSMUST00000105242
AA Change: K536R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100876
Gene: ENSMUSG00000039994
AA Change: K536R

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.1e-102 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 4.4e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105243
SMART Domains Protein: ENSMUSP00000100877
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 7.8e-104 PFAM
low complexity region 381 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105244
AA Change: K536R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100878
Gene: ENSMUSG00000039994
AA Change: K536R

DomainStartEndE-ValueType
Pfam:TIMELESS 21 285 2.3e-103 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1196 5e-187 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105245
AA Change: K536R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100879
Gene: ENSMUSG00000039994
AA Change: K536R

DomainStartEndE-ValueType
Pfam:TIMELESS 24 284 1.1e-81 PFAM
low complexity region 381 395 N/A INTRINSIC
low complexity region 528 537 N/A INTRINSIC
low complexity region 653 682 N/A INTRINSIC
Pfam:TIMELESS_C 722 1197 1.9e-186 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125289
SMART Domains Protein: ENSMUSP00000132079
Gene: ENSMUSG00000039994

DomainStartEndE-ValueType
Pfam:TIMELESS 1 123 3.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146945
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is highly conserved and is involved in cell survival after damage or stress, increase in DNA polymerase epsilon activity, maintenance of telomere length, and epithelial cell morphogenesis. The encoded protein also plays a role in the circadian rhythm autoregulatory loop, interacting with the PERIOD genes (PER1, PER2, and PER3) and others to downregulate activation of PER1 by CLOCK/ARNTL. Changes in this gene or its expression may promote prostate cancer, lung cancer, breast cancer, and mental disorders. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit early embryonic lethality at aprroximately the time of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik A G 5: 109,736,232 C587R probably damaging Het
Abca16 T A 7: 120,534,763 S1320T probably benign Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Acadsb T A 7: 131,444,229 probably null Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Adgre1 T C 17: 57,441,363 V521A probably benign Het
Adh5 G A 3: 138,453,778 V288I probably benign Het
Astn1 A C 1: 158,601,945 N753T probably damaging Het
Atad2 A T 15: 58,096,718 probably null Het
Best3 A G 10: 116,993,273 T153A probably damaging Het
Ccdc122 G A 14: 77,111,407 V226I probably damaging Het
Ccdc175 T C 12: 72,105,926 Q735R probably benign Het
Cd19 T A 7: 126,409,641 I499F probably damaging Het
Cftr T A 6: 18,268,289 L749H probably benign Het
Clec2h G T 6: 128,675,827 G186W probably damaging Het
Cpsf3 T A 12: 21,296,732 I202N probably damaging Het
Crebbp G T 16: 4,087,736 T1669N possibly damaging Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cul4a G A 8: 13,123,565 R204Q probably damaging Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Derl2 A G 11: 71,018,343 F43S probably damaging Het
Dnah14 T A 1: 181,763,960 N3348K probably damaging Het
Dnhd1 T C 7: 105,704,205 V2855A probably benign Het
Dpysl4 G T 7: 139,090,299 C27F probably benign Het
Fam228b G A 12: 4,748,314 A163V probably damaging Het
Fscn1 T C 5: 142,970,063 probably null Het
Fzd5 C A 1: 64,734,994 R536L probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gpr176 T A 2: 118,373,178 N4Y probably damaging Het
Grin3a T C 4: 49,665,309 I1109V possibly damaging Het
H2afy A G 13: 56,083,204 L287P probably damaging Het
Hcar1 T A 5: 123,879,029 I200F probably damaging Het
Heatr4 G A 12: 83,979,728 Q252* probably null Het
Hps1 G A 19: 42,762,449 H371Y probably damaging Het
Ikzf2 T C 1: 69,570,502 T195A probably damaging Het
Kdm1b G A 13: 47,049,190 A34T probably benign Het
Lef1 A G 3: 131,111,641 N57S probably damaging Het
Ltn1 A T 16: 87,416,343 D443E probably benign Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mb A G 15: 77,017,584 Y104H probably damaging Het
Mrc1 C A 2: 14,328,579 P1357Q probably benign Het
Nfib C T 4: 82,323,680 V425M probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1262 G A 2: 90,003,146 V247I probably benign Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr473 A G 7: 107,934,390 Y290C probably damaging Het
Olfr527 G A 7: 140,336,219 R119H possibly damaging Het
Olfr654 T C 7: 104,587,905 S34P probably damaging Het
Olfr732 A T 14: 50,281,391 Y287* probably null Het
Olfr784 T C 10: 129,388,086 F151S probably damaging Het
Olfr916 A T 9: 38,658,365 V9E probably damaging Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Prkaca T C 8: 83,981,223 S46P probably benign Het
Prkcb T G 7: 122,568,201 V378G probably damaging Het
Ptprf A T 4: 118,223,932 L576Q probably damaging Het
Rapgef4 T C 2: 72,234,720 V687A probably benign Het
Rsad2 C T 12: 26,450,617 V224I probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scn1a C T 2: 66,317,982 S1073N probably damaging Het
Slc26a3 A G 12: 31,465,846 M582V probably benign Het
Tbc1d32 A T 10: 56,123,537 Y846* probably null Het
Tbk1 A T 10: 121,547,171 M719K probably benign Het
Tle6 G T 10: 81,594,329 Q330K probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Toe1 T C 4: 116,805,229 Y273C probably damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ubxn11 G A 4: 134,124,838 S32N probably damaging Het
Usp8 G A 2: 126,756,040 C961Y probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r124 G T 17: 18,049,497 W5L probably benign Het
Vmn2r71 A T 7: 85,615,574 D38V probably damaging Het
Vmn2r87 C T 10: 130,479,886 V104I probably benign Het
Vmn2r97 C T 17: 18,947,386 T634I probably benign Het
Vps50 T C 6: 3,520,279 probably null Het
Wwc2 T C 8: 47,990,102 N32S possibly damaging Het
Ythdc2 T A 18: 44,872,956 I1172K possibly damaging Het
Zfp14 C T 7: 30,038,691 V290M probably damaging Het
Zfp317 G A 9: 19,641,984 A18T possibly damaging Het
Zfp354b A T 11: 50,923,542 N185K probably benign Het
Zscan21 T A 5: 138,126,630 D269E probably benign Het
Other mutations in Timeless
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Timeless APN 10 128241708 missense probably damaging 1.00
IGL02157:Timeless APN 10 128242386 missense probably benign 0.01
IGL02300:Timeless APN 10 128244807 missense probably benign 0.00
IGL02587:Timeless APN 10 128239916 missense probably damaging 0.99
IGL02588:Timeless APN 10 128243334 missense probably damaging 1.00
IGL02892:Timeless APN 10 128244251 missense probably damaging 1.00
IGL02930:Timeless APN 10 128247191 missense probably benign 0.00
IGL02986:Timeless APN 10 128249760 missense possibly damaging 0.82
IGL03345:Timeless APN 10 128247586 missense probably benign 0.04
IGL03393:Timeless APN 10 128252055 missense probably damaging 1.00
R0388:Timeless UTSW 10 128241425 splice site probably null
R0607:Timeless UTSW 10 128246334 missense probably benign
R0638:Timeless UTSW 10 128244673 nonsense probably null
R0734:Timeless UTSW 10 128250060 missense probably damaging 1.00
R1346:Timeless UTSW 10 128242365 missense possibly damaging 0.83
R1625:Timeless UTSW 10 128240624 missense probably damaging 0.99
R1771:Timeless UTSW 10 128247608 missense probably benign 0.11
R1920:Timeless UTSW 10 128241714 missense probably damaging 1.00
R1988:Timeless UTSW 10 128244187 missense probably damaging 0.98
R2981:Timeless UTSW 10 128248458 missense probably benign 0.34
R4359:Timeless UTSW 10 128247342 missense probably benign 0.00
R4647:Timeless UTSW 10 128239956 missense possibly damaging 0.80
R4753:Timeless UTSW 10 128240020 utr 5 prime probably benign
R4868:Timeless UTSW 10 128247361 missense probably benign
R4901:Timeless UTSW 10 128250762 missense probably damaging 1.00
R4956:Timeless UTSW 10 128241651 missense probably damaging 1.00
R5341:Timeless UTSW 10 128247178 missense possibly damaging 0.81
R5439:Timeless UTSW 10 128241735 missense probably damaging 1.00
R5585:Timeless UTSW 10 128240243 missense probably damaging 0.97
R5842:Timeless UTSW 10 128247459 critical splice donor site probably null
R5843:Timeless UTSW 10 128244244 splice site probably null
R6005:Timeless UTSW 10 128244200 missense probably damaging 0.99
R6271:Timeless UTSW 10 128250724 missense probably damaging 1.00
R6558:Timeless UTSW 10 128249563 missense probably benign 0.01
R6694:Timeless UTSW 10 128239999 critical splice donor site probably null
R6738:Timeless UTSW 10 128240635 missense probably damaging 1.00
R6760:Timeless UTSW 10 128246117 missense probably benign 0.38
R7213:Timeless UTSW 10 128243289 missense probably benign
R7248:Timeless UTSW 10 128252001 missense probably benign
R7345:Timeless UTSW 10 128249754 missense probably damaging 1.00
R7463:Timeless UTSW 10 128250426 missense probably benign 0.00
R7513:Timeless UTSW 10 128249530 missense probably damaging 0.99
R7574:Timeless UTSW 10 128244669 missense probably damaging 1.00
R8220:Timeless UTSW 10 128246396 missense probably damaging 0.98
X0028:Timeless UTSW 10 128250325 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAATGGCATCTTCCCCTGAC -3'
(R):5'- ACAGACATAGCCATGGGAGC -3'

Sequencing Primer
(F):5'- GGAAATATACAGTGCCCATTGCTGC -3'
(R):5'- CATAGCCATGGGAGCAGGGTG -3'
Posted On2014-06-23