Mutagenetix > Incidental Mutation

Incidental Mutation 'R1860:Ythdc2'

203854

Institutional Source

Beutler Lab

Gene Symbol

Ythdc2

Ensembl Gene

ENSMUSG00000034653

Gene Name

YTH domain containing 2

Synonyms

3010002F02Rik

MMRRC Submission

039883-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1860 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44827746-44889724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 44872956 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 1172 (I1172K)

Ref Sequence

ENSEMBL: ENSMUSP00000048340 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037763] [ENSMUST00000201507]

AlphaFold

B2RR83

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037763
AA Change: I1172K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000048340
Gene: ENSMUSG00000034653
AA Change: I1172K

Domain	Start	End	E-Value	Type
low complexity region	2	50	N/A	INTRINSIC
Pfam:R3H	59	119	1.7e-15	PFAM
DEXDc	206	393	4.95e-26	SMART
low complexity region	413	428	N/A	INTRINSIC
ANK	521	550	2.79e1	SMART
ANK	554	583	1.5e2	SMART
HELICc	648	759	5.31e-17	SMART
HA2	823	916	2.58e-22	SMART
Pfam:OB_NTP_bind	953	1082	1.3e-18	PFAM
low complexity region	1263	1299	N/A	INTRINSIC
Pfam:YTH	1303	1434	7.2e-50	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000201507
AA Change: I517K

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000144479
Gene: ENSMUSG00000034653
AA Change: I517K

Domain	Start	End	E-Value	Type
HELICc	5	104	9.1e-19	SMART
HA2	168	261	2e-26	SMART
Pfam:OB_NTP_bind	298	427	6e-16	PFAM
low complexity region	570	582	N/A	INTRINSIC

Coding Region Coverage

1x: 97.4%
3x: 96.8%
10x: 95.1%
20x: 91.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein binds to N6-methyladenosine, a common modified RNA nucleotide that is enriched in the stop codons and 3' UTRs of eukaryotic messenger RNAs. Binding of proteins to this modified nucleotide may regulate mRNA translation and stability. This gene may be associated with susceptibility to pancreatic cancer in human patients, and knockdown of this gene resulted in reduced proliferation in a human liver cancer cell line. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility with arrested meiosis and small gonads. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	G	5: 109,736,232	C587R	probably damaging	Het
Abca16	T	A	7: 120,534,763	S1320T	probably benign	Het
Abra	C	A	15: 41,869,034	R212L	probably damaging	Het
Acadsb	T	A	7: 131,444,229		probably null	Het
Adam26a	A	G	8: 43,569,541	V304A	possibly damaging	Het
Adgre1	T	C	17: 57,441,363	V521A	probably benign	Het
Adh5	G	A	3: 138,453,778	V288I	probably benign	Het
Astn1	A	C	1: 158,601,945	N753T	probably damaging	Het
Atad2	A	T	15: 58,096,718		probably null	Het
Best3	A	G	10: 116,993,273	T153A	probably damaging	Het
Ccdc122	G	A	14: 77,111,407	V226I	probably damaging	Het
Ccdc175	T	C	12: 72,105,926	Q735R	probably benign	Het
Cd19	T	A	7: 126,409,641	I499F	probably damaging	Het
Cftr	T	A	6: 18,268,289	L749H	probably benign	Het
Clec2h	G	T	6: 128,675,827	G186W	probably damaging	Het
Cpsf3	T	A	12: 21,296,732	I202N	probably damaging	Het
Crebbp	G	T	16: 4,087,736	T1669N	possibly damaging	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Cul4a	G	A	8: 13,123,565	R204Q	probably damaging	Het
D230025D16Rik	A	G	8: 105,240,071	E150G	probably null	Het
Derl2	A	G	11: 71,018,343	F43S	probably damaging	Het
Dnah14	T	A	1: 181,763,960	N3348K	probably damaging	Het
Dnhd1	T	C	7: 105,704,205	V2855A	probably benign	Het
Dpysl4	G	T	7: 139,090,299	C27F	probably benign	Het
Fam228b	G	A	12: 4,748,314	A163V	probably damaging	Het
Fscn1	T	C	5: 142,970,063		probably null	Het
Fzd5	C	A	1: 64,734,994	R536L	probably damaging	Het
Gm8180	T	A	14: 43,783,739	H4L	probably benign	Het
Gpr176	T	A	2: 118,373,178	N4Y	probably damaging	Het
Grin3a	T	C	4: 49,665,309	I1109V	possibly damaging	Het
H2afy	A	G	13: 56,083,204	L287P	probably damaging	Het
Hcar1	T	A	5: 123,879,029	I200F	probably damaging	Het
Heatr4	G	A	12: 83,979,728	Q252*	probably null	Het
Hps1	G	A	19: 42,762,449	H371Y	probably damaging	Het
Ikzf2	T	C	1: 69,570,502	T195A	probably damaging	Het
Kdm1b	G	A	13: 47,049,190	A34T	probably benign	Het
Lef1	A	G	3: 131,111,641	N57S	probably damaging	Het
Ltn1	A	T	16: 87,416,343	D443E	probably benign	Het
Mamdc2	T	C	19: 23,359,153	T331A	probably damaging	Het
March10	A	T	11: 105,397,078	S133T	probably damaging	Het
Mb	A	G	15: 77,017,584	Y104H	probably damaging	Het
Mrc1	C	A	2: 14,328,579	P1357Q	probably benign	Het
Nfib	C	T	4: 82,323,680	V425M	probably damaging	Het
Olfr1197	T	G	2: 88,729,330	I90L	probably damaging	Het
Olfr1262	G	A	2: 90,003,146	V247I	probably benign	Het
Olfr1272	C	A	2: 90,282,158	C139F	probably damaging	Het
Olfr1467	T	A	19: 13,365,341	S238T	possibly damaging	Het
Olfr473	A	G	7: 107,934,390	Y290C	probably damaging	Het
Olfr527	G	A	7: 140,336,219	R119H	possibly damaging	Het
Olfr654	T	C	7: 104,587,905	S34P	probably damaging	Het
Olfr732	A	T	14: 50,281,391	Y287*	probably null	Het
Olfr784	T	C	10: 129,388,086	F151S	probably damaging	Het
Olfr916	A	T	9: 38,658,365	V9E	probably damaging	Het
Piezo1	T	C	8: 122,495,750	N919S	possibly damaging	Het
Prkaca	T	C	8: 83,981,223	S46P	probably benign	Het
Prkcb	T	G	7: 122,568,201	V378G	probably damaging	Het
Ptprf	A	T	4: 118,223,932	L576Q	probably damaging	Het
Rapgef4	T	C	2: 72,234,720	V687A	probably benign	Het
Rsad2	C	T	12: 26,450,617	V224I	probably damaging	Het
Ryr1	A	T	7: 29,009,552	D4796E	unknown	Het
Scn1a	C	T	2: 66,317,982	S1073N	probably damaging	Het
Slc26a3	A	G	12: 31,465,846	M582V	probably benign	Het
Tbc1d32	A	T	10: 56,123,537	Y846*	probably null	Het
Tbk1	A	T	10: 121,547,171	M719K	probably benign	Het
Timeless	A	G	10: 128,246,114	K536R	probably benign	Het
Tle6	G	T	10: 81,594,329	Q330K	probably damaging	Het
Tmem208	A	G	8: 105,334,806	K155E	possibly damaging	Het
Toe1	T	C	4: 116,805,229	Y273C	probably damaging	Het
Tppp2	A	C	14: 51,920,605	N169T	probably benign	Het
Ttll6	T	A	11: 96,138,874	Y204*	probably null	Het
Ubxn11	G	A	4: 134,124,838	S32N	probably damaging	Het
Usp8	G	A	2: 126,756,040	C961Y	probably damaging	Het
Vdac3	A	T	8: 22,580,499	I132K	possibly damaging	Het
Vmn2r124	G	T	17: 18,049,497	W5L	probably benign	Het
Vmn2r71	A	T	7: 85,615,574	D38V	probably damaging	Het
Vmn2r87	C	T	10: 130,479,886	V104I	probably benign	Het
Vmn2r97	C	T	17: 18,947,386	T634I	probably benign	Het
Vps50	T	C	6: 3,520,279		probably null	Het
Wwc2	T	C	8: 47,990,102	N32S	possibly damaging	Het
Zfp14	C	T	7: 30,038,691	V290M	probably damaging	Het
Zfp317	G	A	9: 19,641,984	A18T	possibly damaging	Het
Zfp354b	A	T	11: 50,923,542	N185K	probably benign	Het
Zscan21	T	A	5: 138,126,630	D269E	probably benign	Het

Other mutations in Ythdc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ythdc2	APN	18	44859973	missense	probably benign
IGL00341:Ythdc2	APN	18	44850397	missense	probably benign	0.00
IGL00502:Ythdc2	APN	18	44847812	missense	probably damaging	0.99
IGL00585:Ythdc2	APN	18	44864361	missense	probably damaging	1.00
IGL01081:Ythdc2	APN	18	44850659	missense	probably benign	0.19
IGL01569:Ythdc2	APN	18	44887651	missense	probably benign
IGL01577:Ythdc2	APN	18	44858282	missense	probably benign	0.00
IGL01617:Ythdc2	APN	18	44841415	missense	possibly damaging	0.53
IGL01674:Ythdc2	APN	18	44860404	missense	probably benign	0.04
IGL01736:Ythdc2	APN	18	44850668	missense	probably damaging	0.97
IGL02095:Ythdc2	APN	18	44873140	splice site	probably benign
IGL02245:Ythdc2	APN	18	44862684	missense	possibly damaging	0.74
IGL02524:Ythdc2	APN	18	44847854	missense	probably damaging	0.98
IGL02542:Ythdc2	APN	18	44840241	missense	probably damaging	1.00
IGL02622:Ythdc2	APN	18	44859934	missense	probably damaging	0.99
IGL02795:Ythdc2	APN	18	44837438	missense	possibly damaging	0.95
IGL02935:Ythdc2	APN	18	44855045	missense	probably damaging	1.00
PIT4618001:Ythdc2	UTSW	18	44834598	missense	probably benign	0.19
R0115:Ythdc2	UTSW	18	44841423	splice site	probably benign
R0329:Ythdc2	UTSW	18	44865060	splice site	probably benign
R0472:Ythdc2	UTSW	18	44864357	missense	probably benign	0.02
R0530:Ythdc2	UTSW	18	44850398	missense	probably damaging	0.99
R0547:Ythdc2	UTSW	18	44840264	missense	possibly damaging	0.92
R0563:Ythdc2	UTSW	18	44864848	splice site	probably benign
R0609:Ythdc2	UTSW	18	44864357	missense	probably benign	0.02
R1291:Ythdc2	UTSW	18	44855209	missense	probably benign	0.33
R1469:Ythdc2	UTSW	18	44864462	missense	probably benign	0.00
R1469:Ythdc2	UTSW	18	44864462	missense	probably benign	0.00
R1724:Ythdc2	UTSW	18	44828690	missense	probably benign	0.04
R2040:Ythdc2	UTSW	18	44855174	nonsense	probably null
R2308:Ythdc2	UTSW	18	44847748	missense	possibly damaging	0.95
R3711:Ythdc2	UTSW	18	44833173	missense	probably damaging	0.98
R4005:Ythdc2	UTSW	18	44833128	missense	probably benign	0.00
R4580:Ythdc2	UTSW	18	44858198	missense	possibly damaging	0.81
R4631:Ythdc2	UTSW	18	44887631	missense	probably benign	0.03
R4815:Ythdc2	UTSW	18	44885240	missense	probably benign	0.40
R4924:Ythdc2	UTSW	18	44847804	missense	probably damaging	1.00
R4982:Ythdc2	UTSW	18	44871465	missense	probably benign	0.01
R5011:Ythdc2	UTSW	18	44854742	missense	probably benign	0.38
R5141:Ythdc2	UTSW	18	44865047	missense	probably benign	0.01
R5147:Ythdc2	UTSW	18	44844292	missense	probably damaging	0.98
R5280:Ythdc2	UTSW	18	44860621	missense	probably damaging	1.00
R5388:Ythdc2	UTSW	18	44857025	missense	possibly damaging	0.65
R5928:Ythdc2	UTSW	18	44833205	missense	probably benign
R5931:Ythdc2	UTSW	18	44872956	missense	possibly damaging	0.86
R5995:Ythdc2	UTSW	18	44886253	missense	probably damaging	1.00
R6027:Ythdc2	UTSW	18	44860436	missense	probably benign	0.02
R6056:Ythdc2	UTSW	18	44840210	missense	probably damaging	0.98
R6318:Ythdc2	UTSW	18	44860377	missense	probably benign	0.04
R6399:Ythdc2	UTSW	18	44886402	missense	possibly damaging	0.93
R6586:Ythdc2	UTSW	18	44845788	missense	probably benign	0.00
R6684:Ythdc2	UTSW	18	44873069	missense	possibly damaging	0.47
R7040:Ythdc2	UTSW	18	44834462	missense	probably benign	0.02
R7071:Ythdc2	UTSW	18	44845788	missense	probably benign	0.00
R7105:Ythdc2	UTSW	18	44834563	missense	probably damaging	1.00
R7148:Ythdc2	UTSW	18	44833122	missense	probably benign	0.42
R7290:Ythdc2	UTSW	18	44837491	missense	possibly damaging	0.50
R7806:Ythdc2	UTSW	18	44844286	missense	possibly damaging	0.91
R7806:Ythdc2	UTSW	18	44850424	missense	probably benign	0.05
R8114:Ythdc2	UTSW	18	44877740	missense	probably benign	0.15
R8820:Ythdc2	UTSW	18	44834464	nonsense	probably null
R8840:Ythdc2	UTSW	18	44860624	missense	probably damaging	1.00
R8998:Ythdc2	UTSW	18	44864304	missense	probably benign	0.31
R9065:Ythdc2	UTSW	18	44844351	missense	probably benign	0.00
R9196:Ythdc2	UTSW	18	44855397	missense	probably damaging	0.96
R9251:Ythdc2	UTSW	18	44841375	missense	probably benign	0.00
R9331:Ythdc2	UTSW	18	44837432	missense	possibly damaging	0.87
R9469:Ythdc2	UTSW	18	44886316	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCATTAGAGACGGTTGTAGACC -3'
(R):5'- TGTCCTGGAGAAAATGTACTCATG -3'

Sequencing Primer
(F):5'- TGTAGACCATAAGAAAGTAAAGCAAC -3'
(R):5'- GCATATTCACCTTTCTCCAGTAGTAG -3'

Posted On

2014-06-23