Mutagenetix > Incidental Mutation

Incidental Mutation 'R1861:Col24a1'

203879

Institutional Source

Beutler Lab

Gene Symbol

Col24a1

Ensembl Gene

ENSMUSG00000028197

Gene Name

collagen, type XXIV, alpha 1

Synonyms

5430404K19Rik

MMRRC Submission

039884-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1861 (G1)

Quality Score

206

Status

Validated

Chromosome

Chromosomal Location

145292472-145552011 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 145537267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000029848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029848]

AlphaFold

Q30D77

Predicted Effect

probably null
Transcript: ENSMUST00000029848

SMART Domains

Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197

Domain	Start	End	E-Value	Type
transmembrane domain	21	40	N/A	INTRINSIC
TSPN	41	230	2.7e-3	SMART
LamG	106	229	8.07e-2	SMART
Pfam:Collagen	506	565	9.6e-10	PFAM
Pfam:Collagen	561	623	3.4e-10	PFAM
Pfam:Collagen	604	678	2.3e-9	PFAM
low complexity region	682	724	N/A	INTRINSIC
Pfam:Collagen	772	837	1.3e-10	PFAM
Pfam:Collagen	865	938	6e-9	PFAM
Pfam:Collagen	967	1042	3.1e-8	PFAM
low complexity region	1056	1075	N/A	INTRINSIC
Pfam:Collagen	1107	1180	8e-9	PFAM
Pfam:Collagen	1159	1218	4.2e-10	PFAM
Pfam:Collagen	1218	1279	1.8e-10	PFAM
Pfam:Collagen	1270	1334	3.1e-9	PFAM
Pfam:Collagen	1378	1443	1.3e-9	PFAM
Pfam:Collagen	1439	1500	1.8e-9	PFAM
COLFI	1533	1733	9.34e-34	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127379

Meta Mutation Damage Score

0.9494

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.2%
20x: 92.0%

Validation Efficiency

97% (117/121)

MGI Phenotype

FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	G	13: 63,015,783	Y206C	probably damaging	Het
2610507B11Rik	C	T	11: 78,287,929		probably benign	Het
4930579C12Rik	C	A	9: 89,152,831		noncoding transcript	Het
4933417A18Rik	A	T	13: 34,932,507	I80F	possibly damaging	Het
9530053A07Rik	A	G	7: 28,154,732	Y1707C	probably damaging	Het
Abra	C	A	15: 41,869,034	R212L	probably damaging	Het
Actr1a	T	C	19: 46,384,275	E87G	probably damaging	Het
Adam26a	A	G	8: 43,569,541	V304A	possibly damaging	Het
Alg2	T	A	4: 47,471,670	K379N	probably benign	Het
Alk	G	T	17: 71,874,938		probably benign	Het
Arhgef17	A	G	7: 100,882,268	Y331H	probably damaging	Het
Art3	A	G	5: 92,412,235		probably benign	Het
Asap1	G	A	15: 64,135,798		probably benign	Het
Atad2	A	T	15: 58,096,718		probably null	Het
Atp8b5	G	A	4: 43,372,906	R1150H	probably damaging	Het
B020004J07Rik	A	T	4: 101,836,938	D249E	probably benign	Het
Brdt	T	C	5: 107,359,458	S575P	probably benign	Het
Capn3	T	A	2: 120,486,482		probably benign	Het
Casd1	T	A	6: 4,640,951	Y691N	probably damaging	Het
Ccdc127	T	G	13: 74,356,979	H215Q	possibly damaging	Het
Cenpe	T	C	3: 135,268,979	L2300P	probably damaging	Het
Clasp1	T	C	1: 118,570,931	F898L	possibly damaging	Het
Clcn1	C	A	6: 42,313,991	P933Q	possibly damaging	Het
Cntn3	T	A	6: 102,245,071	N489I	probably benign	Het
Col16a1	T	C	4: 130,061,724		probably benign	Het
Col8a2	C	T	4: 126,311,624		probably benign	Het
Cpd	T	C	11: 76,784,382		probably benign	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Cyp2c40	T	C	19: 39,786,875	Y311C	probably benign	Het
D230025D16Rik	A	G	8: 105,240,071	E150G	probably null	Het
Dennd5b	T	A	6: 149,068,262	N231I	probably damaging	Het
Dgkh	T	A	14: 78,578,792	H936L	probably benign	Het
Dmtf1	T	C	5: 9,120,347		probably null	Het
Dnaic2	T	C	11: 114,752,951	V481A	possibly damaging	Het
Dpyd	T	G	3: 118,917,131	V396G	probably damaging	Het
Elmo3	A	G	8: 105,308,581	D448G	probably damaging	Het
Emsy	A	T	7: 98,641,615	V100E	probably damaging	Het
Erbb2	T	C	11: 98,412,737		probably null	Het
Faah	T	C	4: 116,008,235	K85R	probably benign	Het
Fam149a	A	T	8: 45,339,362	Y686*	probably null	Het
Fat4	T	C	3: 39,010,484	V4863A	probably benign	Het
Fbxl8	A	G	8: 105,268,929	T358A	probably damaging	Het
Fgfr3	A	G	5: 33,729,746	T165A	probably damaging	Het
Fnbp1l	A	T	3: 122,560,932	H180Q	probably damaging	Het
Gm8180	T	A	14: 43,783,739	H4L	probably benign	Het
Gon4l	T	C	3: 88,895,487	V1135A	probably damaging	Het
Gstcd	G	T	3: 132,983,107	N627K	probably damaging	Het
Gtf2a1l	G	A	17: 88,714,954	V458I	probably damaging	Het
Gtf3c3	T	C	1: 54,438,838	E26G	possibly damaging	Het
Hrct1	A	T	4: 43,727,404	T15S	probably benign	Het
Ift122	C	A	6: 115,891,928	R459S	probably damaging	Het
Irf1	T	A	11: 53,774,357	C187S	possibly damaging	Het
Kcnh7	A	G	2: 62,777,392	V615A	probably damaging	Het
Kif1c	T	C	11: 70,703,342	S61P	probably damaging	Het
Mamdc2	T	C	19: 23,359,153	T331A	probably damaging	Het
Mark2	T	C	19: 7,290,763	D25G	possibly damaging	Het
Me2	T	C	18: 73,785,714	D432G	probably benign	Het
Mfap3	T	C	11: 57,528,206	V64A	probably benign	Het
Nadk2	T	A	15: 9,108,311	M416K	probably benign	Het
Ndufs1	C	T	1: 63,147,417	G631D	probably benign	Het
Nomo1	G	A	7: 46,078,101	V1055I	probably benign	Het
Nuggc	T	A	14: 65,642,001		probably benign	Het
Nwd2	T	C	5: 63,804,854	S594P	probably damaging	Het
Olfr1197	T	G	2: 88,729,330	I90L	probably damaging	Het
Olfr1272	C	A	2: 90,282,158	C139F	probably damaging	Het
Olfr1467	T	A	19: 13,365,341	S238T	possibly damaging	Het
Olfr250	C	T	9: 38,367,606	S10L	probably benign	Het
Olfr273	T	A	4: 52,856,373	I47L	probably benign	Het
Olfr414	T	C	1: 174,431,091	I221T	probably damaging	Het
Palm2	A	G	4: 57,709,468	I138V	probably damaging	Het
Pcyt2	G	A	11: 120,611,142	P332S	probably benign	Het
Phf14	A	T	6: 11,987,611	M630L	probably benign	Het
Piezo1	T	C	8: 122,495,750	N919S	possibly damaging	Het
Pif1	A	T	9: 65,589,453	I283F	probably damaging	Het
Pknox2	G	A	9: 36,923,661	H171Y	probably damaging	Het
Prkg2	T	A	5: 98,947,416	D632V	probably damaging	Het
Prr29	G	A	11: 106,375,438	A6T	probably damaging	Het
Rims1	T	A	1: 22,596,558	Y114F	probably damaging	Het
Ryr1	A	T	7: 29,009,552	D4796E	unknown	Het
Scnn1b	G	A	7: 121,914,261	C399Y	probably damaging	Het
Scp2	T	C	4: 108,091,321	Y153C	probably damaging	Het
Sema3d	A	G	5: 12,497,603	K164R	probably benign	Het
Siglecf	A	G	7: 43,352,224	T153A	probably benign	Het
Siglecf	A	G	7: 43,355,543	N399S	probably benign	Het
Skint2	T	C	4: 112,647,118		probably benign	Het
Slc22a8	G	A	19: 8,606,139	R236H	probably damaging	Het
Slc25a40	T	A	5: 8,442,431		probably null	Het
Slc26a5	T	C	5: 21,816,958	D490G	possibly damaging	Het
Slc26a7	G	T	4: 14,522,873	D482E	probably benign	Het
Smarca2	A	T	19: 26,623,884	M77L	probably benign	Het
Sos2	A	G	12: 69,617,363	L449P	probably damaging	Het
Spaca1	A	G	4: 34,044,206	V96A	probably damaging	Het
Spata31d1b	T	A	13: 59,717,336	I766N	possibly damaging	Het
Specc1l	T	C	10: 75,309,859	Y1113H	probably damaging	Het
Speg	A	G	1: 75,389,005	R677G	probably damaging	Het
Taf5l	A	T	8: 123,997,990	D363E	probably damaging	Het
Tmem208	A	G	8: 105,334,806	K155E	possibly damaging	Het
Tppp2	A	C	14: 51,920,605	N169T	probably benign	Het
Trrap	T	A	5: 144,815,917		probably null	Het
Ttll6	T	A	11: 96,138,874	Y204*	probably null	Het
Ttn	A	T	2: 76,772,648	I18410K	probably benign	Het
V1rd19	T	A	7: 24,003,724	V205D	probably damaging	Het
Vdac3	A	T	8: 22,580,499	I132K	possibly damaging	Het
Vmn2r95	T	G	17: 18,452,268	C756G	probably damaging	Het
Wdr63	T	C	3: 146,083,046	Y260C	probably damaging	Het
Zc3h15	A	G	2: 83,663,990	T421A	unknown	Het
Zc3hc1	T	C	6: 30,374,838	T235A	probably benign	Het
Zcchc14	A	G	8: 121,609,251		probably benign	Het
Zfp318	T	A	17: 46,411,440	N1456K	possibly damaging	Het
Zfp606	A	G	7: 12,480,931		probably benign	Het
Zfp811	T	A	17: 32,797,425	H546L	probably damaging	Het
Zfp94	A	T	7: 24,309,116	Y33N	probably damaging	Het
Zfyve9	G	T	4: 108,682,295		probably benign	Het

Other mutations in Col24a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Col24a1	APN	3	145362309	missense	probably damaging	1.00
IGL00931:Col24a1	APN	3	145461470	missense	probably benign	0.00
IGL01160:Col24a1	APN	3	145507713	missense	probably damaging	1.00
IGL01355:Col24a1	APN	3	145314876	missense	probably benign	0.07
IGL01409:Col24a1	APN	3	145538564	missense	probably benign	0.19
IGL01587:Col24a1	APN	3	145433355	splice site	probably null
IGL01666:Col24a1	APN	3	145344686	missense	possibly damaging	0.93
IGL01717:Col24a1	APN	3	145524263	splice site	probably benign
IGL01721:Col24a1	APN	3	145538567	missense	probably benign	0.26
IGL01939:Col24a1	APN	3	145315244	missense	probably damaging	1.00
IGL01988:Col24a1	APN	3	145524167	splice site	probably null
IGL02002:Col24a1	APN	3	145356944	missense	possibly damaging	0.81
IGL02172:Col24a1	APN	3	145314962	missense	probably benign	0.34
IGL02552:Col24a1	APN	3	145474207	missense	possibly damaging	0.88
IGL02559:Col24a1	APN	3	145314173	missense	probably benign
IGL02582:Col24a1	APN	3	145314486	missense	probably damaging	1.00
IGL02652:Col24a1	APN	3	145492301	nonsense	probably null
IGL02942:Col24a1	APN	3	145541665	missense	probably damaging	1.00
IGL03032:Col24a1	APN	3	145538703	critical splice donor site	probably null
IGL03108:Col24a1	APN	3	145323401	missense	probably damaging	1.00
IGL03310:Col24a1	APN	3	145313983	splice site	probably benign
IGL03405:Col24a1	APN	3	145315157	missense	possibly damaging	0.73
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0066:Col24a1	UTSW	3	145545144	missense	probably damaging	1.00
R0379:Col24a1	UTSW	3	145524142	missense	possibly damaging	0.94
R0502:Col24a1	UTSW	3	145545316	splice site	probably benign
R0556:Col24a1	UTSW	3	145314728	missense	possibly damaging	0.53
R0587:Col24a1	UTSW	3	145293145	missense	possibly damaging	0.50
R0617:Col24a1	UTSW	3	145314120	missense	probably damaging	1.00
R0831:Col24a1	UTSW	3	145328759	missense	probably damaging	1.00
R1455:Col24a1	UTSW	3	145460838	missense	probably damaging	1.00
R1664:Col24a1	UTSW	3	145389600	critical splice donor site	probably null
R1713:Col24a1	UTSW	3	145366869	nonsense	probably null
R1854:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1855:Col24a1	UTSW	3	145459140	missense	probably damaging	1.00
R1969:Col24a1	UTSW	3	145314930	missense	probably benign	0.03
R2216:Col24a1	UTSW	3	145314981	missense	probably benign	0.34
R2290:Col24a1	UTSW	3	145513195	missense	probably damaging	1.00
R3702:Col24a1	UTSW	3	145337860	missense	probably benign	0.01
R3772:Col24a1	UTSW	3	145545286	missense	probably damaging	1.00
R4086:Col24a1	UTSW	3	145461437	missense	probably damaging	1.00
R4236:Col24a1	UTSW	3	145524282	nonsense	probably null
R4433:Col24a1	UTSW	3	145314383	missense	possibly damaging	0.95
R4688:Col24a1	UTSW	3	145314383	missense	probably benign	0.00
R4972:Col24a1	UTSW	3	145509684	missense	probably benign	0.42
R5157:Col24a1	UTSW	3	145345951	nonsense	probably null
R5216:Col24a1	UTSW	3	145315310	missense	possibly damaging	0.85
R5274:Col24a1	UTSW	3	145484678	missense	probably benign	0.03
R5334:Col24a1	UTSW	3	145461525	missense	possibly damaging	0.91
R5416:Col24a1	UTSW	3	145315025	nonsense	probably null
R5473:Col24a1	UTSW	3	145537261	missense	probably benign	0.41
R5538:Col24a1	UTSW	3	145293121	missense	probably damaging	0.99
R5561:Col24a1	UTSW	3	145298827	missense	probably benign	0.26
R5648:Col24a1	UTSW	3	145358566	missense	probably benign	0.00
R5920:Col24a1	UTSW	3	145428230	missense	probably damaging	1.00
R6111:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6151:Col24a1	UTSW	3	145314054	missense	probably damaging	0.99
R6701:Col24a1	UTSW	3	145314380	missense	probably benign	0.00
R6728:Col24a1	UTSW	3	145315196	missense	probably benign
R6734:Col24a1	UTSW	3	145508674	missense	probably benign	0.06
R6861:Col24a1	UTSW	3	145460834	missense	probably damaging	1.00
R6982:Col24a1	UTSW	3	145315046	nonsense	probably null
R7001:Col24a1	UTSW	3	145298866	missense	probably benign	0.28
R7148:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R7293:Col24a1	UTSW	3	145486304	nonsense	probably null
R7315:Col24a1	UTSW	3	145431870	missense	possibly damaging	0.82
R7358:Col24a1	UTSW	3	145293165	critical splice donor site	probably null
R7371:Col24a1	UTSW	3	145343698	missense	probably benign	0.06
R7383:Col24a1	UTSW	3	145298838	missense	probably benign
R7605:Col24a1	UTSW	3	145538687	missense	possibly damaging	0.67
R7650:Col24a1	UTSW	3	145314453	missense	probably benign	0.00
R7679:Col24a1	UTSW	3	145399355	missense	possibly damaging	0.81
R7701:Col24a1	UTSW	3	145315011	missense	probably benign
R7701:Col24a1	UTSW	3	145366901	splice site	probably null
R7805:Col24a1	UTSW	3	145314140	missense	probably benign	0.02
R7913:Col24a1	UTSW	3	145431866	nonsense	probably null
R7921:Col24a1	UTSW	3	145474238	missense	probably damaging	1.00
R8056:Col24a1	UTSW	3	145314164	missense	possibly damaging	0.73
R8240:Col24a1	UTSW	3	145507702	missense	probably benign	0.31
R8294:Col24a1	UTSW	3	145481089	missense	probably null	1.00
R8305:Col24a1	UTSW	3	145474182	missense	probably benign	0.00
R8430:Col24a1	UTSW	3	145315299	missense	probably damaging	1.00
R8708:Col24a1	UTSW	3	145545265	missense	probably damaging	0.99
R8880:Col24a1	UTSW	3	145314037	missense	probably null
R9056:Col24a1	UTSW	3	145315248	missense	probably damaging	0.96
R9461:Col24a1	UTSW	3	145481124	nonsense	probably null
R9612:Col24a1	UTSW	3	145545205	missense	probably benign	0.32
R9777:Col24a1	UTSW	3	145315342	nonsense	probably null
Z1176:Col24a1	UTSW	3	145342498	missense	probably damaging	1.00
Z1177:Col24a1	UTSW	3	145342499	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTCGCATCAAGGCTCCCAG -3'
(R):5'- ACACCCCGTGTATGTATTTCG -3'

Sequencing Primer
(F):5'- CCAGAACAAAATGAACAGAGGTTGTC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'

Posted On

2014-06-23