Mutagenetix > Incidental Mutation

Incidental Mutation 'R1861:Brdt'

203902

Institutional Source

Beutler Lab

Gene Symbol

Brdt

Ensembl Gene

ENSMUSG00000029279

Gene Name

bromodomain, testis-specific

Synonyms

Fsrg3, 7420412D09Rik, Brd6

MMRRC Submission

039884-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1861 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

107331159-107387058 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107359458 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 575 (S575P)

Ref Sequence

ENSEMBL: ENSMUSP00000031215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031215]

AlphaFold

Q91Y44

PDB Structure

Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000031215
AA Change: S575P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: S575P

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
BROMO	268	377	2.18e-40	SMART
low complexity region	392	417	N/A	INTRINSIC
low complexity region	446	455	N/A	INTRINSIC
low complexity region	472	500	N/A	INTRINSIC
Pfam:BET	505	569	9.2e-34	PFAM
low complexity region	585	603	N/A	INTRINSIC
low complexity region	649	691	N/A	INTRINSIC
low complexity region	895	909	N/A	INTRINSIC
Pfam:BRD4_CDT	913	956	3e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162804

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.2%
20x: 92.0%

Validation Efficiency

97% (117/121)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	G	13: 63,015,783	Y206C	probably damaging	Het
2610507B11Rik	C	T	11: 78,287,929		probably benign	Het
4930579C12Rik	C	A	9: 89,152,831		noncoding transcript	Het
4933417A18Rik	A	T	13: 34,932,507	I80F	possibly damaging	Het
9530053A07Rik	A	G	7: 28,154,732	Y1707C	probably damaging	Het
Abra	C	A	15: 41,869,034	R212L	probably damaging	Het
Actr1a	T	C	19: 46,384,275	E87G	probably damaging	Het
Adam26a	A	G	8: 43,569,541	V304A	possibly damaging	Het
Alg2	T	A	4: 47,471,670	K379N	probably benign	Het
Alk	G	T	17: 71,874,938		probably benign	Het
Arhgef17	A	G	7: 100,882,268	Y331H	probably damaging	Het
Art3	A	G	5: 92,412,235		probably benign	Het
Asap1	G	A	15: 64,135,798		probably benign	Het
Atad2	A	T	15: 58,096,718		probably null	Het
Atp8b5	G	A	4: 43,372,906	R1150H	probably damaging	Het
B020004J07Rik	A	T	4: 101,836,938	D249E	probably benign	Het
Capn3	T	A	2: 120,486,482		probably benign	Het
Casd1	T	A	6: 4,640,951	Y691N	probably damaging	Het
Ccdc127	T	G	13: 74,356,979	H215Q	possibly damaging	Het
Cenpe	T	C	3: 135,268,979	L2300P	probably damaging	Het
Clasp1	T	C	1: 118,570,931	F898L	possibly damaging	Het
Clcn1	C	A	6: 42,313,991	P933Q	possibly damaging	Het
Cntn3	T	A	6: 102,245,071	N489I	probably benign	Het
Col16a1	T	C	4: 130,061,724		probably benign	Het
Col24a1	G	A	3: 145,537,267		probably null	Het
Col8a2	C	T	4: 126,311,624		probably benign	Het
Cpd	T	C	11: 76,784,382		probably benign	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Cyp2c40	T	C	19: 39,786,875	Y311C	probably benign	Het
D230025D16Rik	A	G	8: 105,240,071	E150G	probably null	Het
Dennd5b	T	A	6: 149,068,262	N231I	probably damaging	Het
Dgkh	T	A	14: 78,578,792	H936L	probably benign	Het
Dmtf1	T	C	5: 9,120,347		probably null	Het
Dnaic2	T	C	11: 114,752,951	V481A	possibly damaging	Het
Dpyd	T	G	3: 118,917,131	V396G	probably damaging	Het
Elmo3	A	G	8: 105,308,581	D448G	probably damaging	Het
Emsy	A	T	7: 98,641,615	V100E	probably damaging	Het
Erbb2	T	C	11: 98,412,737		probably null	Het
Faah	T	C	4: 116,008,235	K85R	probably benign	Het
Fam149a	A	T	8: 45,339,362	Y686*	probably null	Het
Fat4	T	C	3: 39,010,484	V4863A	probably benign	Het
Fbxl8	A	G	8: 105,268,929	T358A	probably damaging	Het
Fgfr3	A	G	5: 33,729,746	T165A	probably damaging	Het
Fnbp1l	A	T	3: 122,560,932	H180Q	probably damaging	Het
Gm8180	T	A	14: 43,783,739	H4L	probably benign	Het
Gon4l	T	C	3: 88,895,487	V1135A	probably damaging	Het
Gstcd	G	T	3: 132,983,107	N627K	probably damaging	Het
Gtf2a1l	G	A	17: 88,714,954	V458I	probably damaging	Het
Gtf3c3	T	C	1: 54,438,838	E26G	possibly damaging	Het
Hrct1	A	T	4: 43,727,404	T15S	probably benign	Het
Ift122	C	A	6: 115,891,928	R459S	probably damaging	Het
Irf1	T	A	11: 53,774,357	C187S	possibly damaging	Het
Kcnh7	A	G	2: 62,777,392	V615A	probably damaging	Het
Kif1c	T	C	11: 70,703,342	S61P	probably damaging	Het
Mamdc2	T	C	19: 23,359,153	T331A	probably damaging	Het
Mark2	T	C	19: 7,290,763	D25G	possibly damaging	Het
Me2	T	C	18: 73,785,714	D432G	probably benign	Het
Mfap3	T	C	11: 57,528,206	V64A	probably benign	Het
Nadk2	T	A	15: 9,108,311	M416K	probably benign	Het
Ndufs1	C	T	1: 63,147,417	G631D	probably benign	Het
Nomo1	G	A	7: 46,078,101	V1055I	probably benign	Het
Nuggc	T	A	14: 65,642,001		probably benign	Het
Nwd2	T	C	5: 63,804,854	S594P	probably damaging	Het
Olfr1197	T	G	2: 88,729,330	I90L	probably damaging	Het
Olfr1272	C	A	2: 90,282,158	C139F	probably damaging	Het
Olfr1467	T	A	19: 13,365,341	S238T	possibly damaging	Het
Olfr250	C	T	9: 38,367,606	S10L	probably benign	Het
Olfr273	T	A	4: 52,856,373	I47L	probably benign	Het
Olfr414	T	C	1: 174,431,091	I221T	probably damaging	Het
Palm2	A	G	4: 57,709,468	I138V	probably damaging	Het
Pcyt2	G	A	11: 120,611,142	P332S	probably benign	Het
Phf14	A	T	6: 11,987,611	M630L	probably benign	Het
Piezo1	T	C	8: 122,495,750	N919S	possibly damaging	Het
Pif1	A	T	9: 65,589,453	I283F	probably damaging	Het
Pknox2	G	A	9: 36,923,661	H171Y	probably damaging	Het
Prkg2	T	A	5: 98,947,416	D632V	probably damaging	Het
Prr29	G	A	11: 106,375,438	A6T	probably damaging	Het
Rims1	T	A	1: 22,596,558	Y114F	probably damaging	Het
Ryr1	A	T	7: 29,009,552	D4796E	unknown	Het
Scnn1b	G	A	7: 121,914,261	C399Y	probably damaging	Het
Scp2	T	C	4: 108,091,321	Y153C	probably damaging	Het
Sema3d	A	G	5: 12,497,603	K164R	probably benign	Het
Siglecf	A	G	7: 43,352,224	T153A	probably benign	Het
Siglecf	A	G	7: 43,355,543	N399S	probably benign	Het
Skint2	T	C	4: 112,647,118		probably benign	Het
Slc22a8	G	A	19: 8,606,139	R236H	probably damaging	Het
Slc25a40	T	A	5: 8,442,431		probably null	Het
Slc26a5	T	C	5: 21,816,958	D490G	possibly damaging	Het
Slc26a7	G	T	4: 14,522,873	D482E	probably benign	Het
Smarca2	A	T	19: 26,623,884	M77L	probably benign	Het
Sos2	A	G	12: 69,617,363	L449P	probably damaging	Het
Spaca1	A	G	4: 34,044,206	V96A	probably damaging	Het
Spata31d1b	T	A	13: 59,717,336	I766N	possibly damaging	Het
Specc1l	T	C	10: 75,309,859	Y1113H	probably damaging	Het
Speg	A	G	1: 75,389,005	R677G	probably damaging	Het
Taf5l	A	T	8: 123,997,990	D363E	probably damaging	Het
Tmem208	A	G	8: 105,334,806	K155E	possibly damaging	Het
Tppp2	A	C	14: 51,920,605	N169T	probably benign	Het
Trrap	T	A	5: 144,815,917		probably null	Het
Ttll6	T	A	11: 96,138,874	Y204*	probably null	Het
Ttn	A	T	2: 76,772,648	I18410K	probably benign	Het
V1rd19	T	A	7: 24,003,724	V205D	probably damaging	Het
Vdac3	A	T	8: 22,580,499	I132K	possibly damaging	Het
Vmn2r95	T	G	17: 18,452,268	C756G	probably damaging	Het
Wdr63	T	C	3: 146,083,046	Y260C	probably damaging	Het
Zc3h15	A	G	2: 83,663,990	T421A	unknown	Het
Zc3hc1	T	C	6: 30,374,838	T235A	probably benign	Het
Zcchc14	A	G	8: 121,609,251		probably benign	Het
Zfp318	T	A	17: 46,411,440	N1456K	possibly damaging	Het
Zfp606	A	G	7: 12,480,931		probably benign	Het
Zfp811	T	A	17: 32,797,425	H546L	probably damaging	Het
Zfp94	A	T	7: 24,309,116	Y33N	probably damaging	Het
Zfyve9	G	T	4: 108,682,295		probably benign	Het

Other mutations in Brdt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02342:Brdt	APN	5	107342203	missense	probably damaging	1.00
IGL02718:Brdt	APN	5	107350068	splice site	probably benign
IGL02746:Brdt	APN	5	107370324	missense	probably benign
IGL02851:Brdt	APN	5	107377995	missense	possibly damaging	0.47
R0585:Brdt	UTSW	5	107356882	critical splice donor site	probably null
R0708:Brdt	UTSW	5	107358900	nonsense	probably null
R1338:Brdt	UTSW	5	107350188	missense	probably benign	0.02
R1710:Brdt	UTSW	5	107343584	missense	probably damaging	1.00
R1794:Brdt	UTSW	5	107359853	small deletion	probably benign
R1913:Brdt	UTSW	5	107348613	missense	probably benign
R2029:Brdt	UTSW	5	107359224	missense	probably benign	0.35
R2431:Brdt	UTSW	5	107378015	splice site	probably null
R3121:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R3122:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R4258:Brdt	UTSW	5	107359909	missense	probably damaging	0.97
R4609:Brdt	UTSW	5	107359936	missense	probably benign	0.00
R5306:Brdt	UTSW	5	107345144	missense	probably damaging	1.00
R5640:Brdt	UTSW	5	107359308	nonsense	probably null
R5677:Brdt	UTSW	5	107348617	missense	possibly damaging	0.85
R5936:Brdt	UTSW	5	107359395	missense	probably damaging	1.00
R6145:Brdt	UTSW	5	107377999	missense	possibly damaging	0.67
R6261:Brdt	UTSW	5	107348503	missense	probably benign	0.04
R6408:Brdt	UTSW	5	107385492	missense	probably damaging	1.00
R6930:Brdt	UTSW	5	107359215	missense	probably benign	0.35
R7372:Brdt	UTSW	5	107370294	missense	possibly damaging	0.49
R7741:Brdt	UTSW	5	107358886	missense	probably benign	0.00
R7842:Brdt	UTSW	5	107348588	missense	possibly damaging	0.49
R7869:Brdt	UTSW	5	107370179	missense	probably benign	0.04
R7887:Brdt	UTSW	5	107359933	missense	possibly damaging	0.66
R7972:Brdt	UTSW	5	107348549	missense	possibly damaging	0.53
R8064:Brdt	UTSW	5	107377996	nonsense	probably null
R8958:Brdt	UTSW	5	107378011	missense	probably benign
R9199:Brdt	UTSW	5	107350163	nonsense	probably null
R9346:Brdt	UTSW	5	107377014	missense	probably damaging	0.99
X0011:Brdt	UTSW	5	107342128	missense	probably damaging	0.96
X0011:Brdt	UTSW	5	107377092	missense	probably damaging	1.00
Z1176:Brdt	UTSW	5	107359898	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- GCAGCTGAGCTTGGACATAAAC -3'
(R):5'- TTCAGCTGATTGTTGACGTCC -3'

Sequencing Primer
(F):5'- TTGGACATAAACAAACTGCCTGG -3'
(R):5'- GATTGTTGACGTCCAGCAAC -3'

Posted On

2014-06-23