Incidental Mutation 'R1861:Clcn1'
ID203907
Institutional Source Beutler Lab
Gene Symbol Clcn1
Ensembl Gene ENSMUSG00000029862
Gene Namechloride channel, voltage-sensitive 1
SynonymsClc1, SMCC1, nmf355, NMF355, Clc-1
MMRRC Submission 039884-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1861 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42286685-42315756 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 42313991 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 933 (P933Q)
Ref Sequence ENSEMBL: ENSMUSP00000031894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031891] [ENSMUST00000031894] [ENSMUST00000095974] [ENSMUST00000143278] [ENSMUST00000164091] [ENSMUST00000168660]
Predicted Effect probably benign
Transcript: ENSMUST00000031891
SMART Domains Protein: ENSMUSP00000031891
Gene: ENSMUSG00000029861

DomainStartEndE-ValueType
Pfam:FAM131 49 341 7.4e-128 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000031894
AA Change: P933Q

PolyPhen 2 Score 0.634 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031894
Gene: ENSMUSG00000029862
AA Change: P933Q

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 572 3.2e-87 PFAM
Blast:CBS 612 662 1e-24 BLAST
low complexity region 723 747 N/A INTRINSIC
Blast:CBS 830 877 4e-19 BLAST
low complexity region 928 950 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095974
SMART Domains Protein: ENSMUSP00000093670
Gene: ENSMUSG00000029861

DomainStartEndE-ValueType
Pfam:FAM131 33 325 4.5e-128 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114684
SMART Domains Protein: ENSMUSP00000110332
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
Pfam:Voltage_CLC 3 254 2.6e-42 PFAM
CBS 294 344 1.3e1 SMART
low complexity region 405 429 N/A INTRINSIC
Blast:CBS 480 524 2e-13 BLAST
low complexity region 575 597 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143278
SMART Domains Protein: ENSMUSP00000116779
Gene: ENSMUSG00000029861

DomainStartEndE-ValueType
Pfam:FAM131 61 353 1.9e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163235
SMART Domains Protein: ENSMUSP00000132387
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000163936
AA Change: P861Q
SMART Domains Protein: ENSMUSP00000130148
Gene: ENSMUSG00000029862
AA Change: P861Q

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 1.2e-27 PFAM
Pfam:Voltage_CLC 258 501 3.9e-44 PFAM
PDB:2D4Z|B 520 807 2e-47 PDB
Blast:CBS 541 591 2e-24 BLAST
Blast:CBS 759 806 3e-19 BLAST
low complexity region 857 879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164091
SMART Domains Protein: ENSMUSP00000131354
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 121 130 N/A INTRINSIC
Pfam:Voltage_CLC 170 256 2.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165780
SMART Domains Protein: ENSMUSP00000130550
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 227 9.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168660
SMART Domains Protein: ENSMUSP00000126045
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
Pfam:Voltage_CLC 136 257 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169024
SMART Domains Protein: ENSMUSP00000130968
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 261 2.9e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169902
Predicted Effect probably benign
Transcript: ENSMUST00000170028
SMART Domains Protein: ENSMUSP00000132154
Gene: ENSMUSG00000029862

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Pfam:Voltage_CLC 141 235 8e-22 PFAM
Meta Mutation Damage Score 0.0618 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. The protein encoded by this gene regulates the electric excitability of the skeletal muscle membrane. Mutations in this gene cause two forms of inherited human muscle disorders: recessive generalized myotonia congenita (Becker) and dominant myotonia (Thomsen). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mutant mice exhibit mild to severe spasms of the hind limbs and abnormal hind limb reflexes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A G 13: 63,015,783 Y206C probably damaging Het
2610507B11Rik C T 11: 78,287,929 probably benign Het
4930579C12Rik C A 9: 89,152,831 noncoding transcript Het
4933417A18Rik A T 13: 34,932,507 I80F possibly damaging Het
9530053A07Rik A G 7: 28,154,732 Y1707C probably damaging Het
Abra C A 15: 41,869,034 R212L probably damaging Het
Actr1a T C 19: 46,384,275 E87G probably damaging Het
Adam26a A G 8: 43,569,541 V304A possibly damaging Het
Alg2 T A 4: 47,471,670 K379N probably benign Het
Alk G T 17: 71,874,938 probably benign Het
Arhgef17 A G 7: 100,882,268 Y331H probably damaging Het
Art3 A G 5: 92,412,235 probably benign Het
Asap1 G A 15: 64,135,798 probably benign Het
Atad2 A T 15: 58,096,718 probably null Het
Atp8b5 G A 4: 43,372,906 R1150H probably damaging Het
B020004J07Rik A T 4: 101,836,938 D249E probably benign Het
Brdt T C 5: 107,359,458 S575P probably benign Het
Capn3 T A 2: 120,486,482 probably benign Het
Casd1 T A 6: 4,640,951 Y691N probably damaging Het
Ccdc127 T G 13: 74,356,979 H215Q possibly damaging Het
Cenpe T C 3: 135,268,979 L2300P probably damaging Het
Clasp1 T C 1: 118,570,931 F898L possibly damaging Het
Cntn3 T A 6: 102,245,071 N489I probably benign Het
Col16a1 T C 4: 130,061,724 probably benign Het
Col24a1 G A 3: 145,537,267 probably null Het
Col8a2 C T 4: 126,311,624 probably benign Het
Cpd T C 11: 76,784,382 probably benign Het
Csmd3 A T 15: 47,659,192 C2694S probably damaging Het
Cyp2c40 T C 19: 39,786,875 Y311C probably benign Het
D230025D16Rik A G 8: 105,240,071 E150G probably null Het
Dennd5b T A 6: 149,068,262 N231I probably damaging Het
Dgkh T A 14: 78,578,792 H936L probably benign Het
Dmtf1 T C 5: 9,120,347 probably null Het
Dnaic2 T C 11: 114,752,951 V481A possibly damaging Het
Dpyd T G 3: 118,917,131 V396G probably damaging Het
Elmo3 A G 8: 105,308,581 D448G probably damaging Het
Emsy A T 7: 98,641,615 V100E probably damaging Het
Erbb2 T C 11: 98,412,737 probably null Het
Faah T C 4: 116,008,235 K85R probably benign Het
Fam149a A T 8: 45,339,362 Y686* probably null Het
Fat4 T C 3: 39,010,484 V4863A probably benign Het
Fbxl8 A G 8: 105,268,929 T358A probably damaging Het
Fgfr3 A G 5: 33,729,746 T165A probably damaging Het
Fnbp1l A T 3: 122,560,932 H180Q probably damaging Het
Gm8180 T A 14: 43,783,739 H4L probably benign Het
Gon4l T C 3: 88,895,487 V1135A probably damaging Het
Gstcd G T 3: 132,983,107 N627K probably damaging Het
Gtf2a1l G A 17: 88,714,954 V458I probably damaging Het
Gtf3c3 T C 1: 54,438,838 E26G possibly damaging Het
Hrct1 A T 4: 43,727,404 T15S probably benign Het
Ift122 C A 6: 115,891,928 R459S probably damaging Het
Irf1 T A 11: 53,774,357 C187S possibly damaging Het
Kcnh7 A G 2: 62,777,392 V615A probably damaging Het
Kif1c T C 11: 70,703,342 S61P probably damaging Het
Mamdc2 T C 19: 23,359,153 T331A probably damaging Het
Mark2 T C 19: 7,290,763 D25G possibly damaging Het
Me2 T C 18: 73,785,714 D432G probably benign Het
Mfap3 T C 11: 57,528,206 V64A probably benign Het
Nadk2 T A 15: 9,108,311 M416K probably benign Het
Ndufs1 C T 1: 63,147,417 G631D probably benign Het
Nomo1 G A 7: 46,078,101 V1055I probably benign Het
Nuggc T A 14: 65,642,001 probably benign Het
Nwd2 T C 5: 63,804,854 S594P probably damaging Het
Olfr1197 T G 2: 88,729,330 I90L probably damaging Het
Olfr1272 C A 2: 90,282,158 C139F probably damaging Het
Olfr1467 T A 19: 13,365,341 S238T possibly damaging Het
Olfr250 C T 9: 38,367,606 S10L probably benign Het
Olfr273 T A 4: 52,856,373 I47L probably benign Het
Olfr414 T C 1: 174,431,091 I221T probably damaging Het
Palm2 A G 4: 57,709,468 I138V probably damaging Het
Pcyt2 G A 11: 120,611,142 P332S probably benign Het
Phf14 A T 6: 11,987,611 M630L probably benign Het
Piezo1 T C 8: 122,495,750 N919S possibly damaging Het
Pif1 A T 9: 65,589,453 I283F probably damaging Het
Pknox2 G A 9: 36,923,661 H171Y probably damaging Het
Prkg2 T A 5: 98,947,416 D632V probably damaging Het
Prr29 G A 11: 106,375,438 A6T probably damaging Het
Rims1 T A 1: 22,596,558 Y114F probably damaging Het
Ryr1 A T 7: 29,009,552 D4796E unknown Het
Scnn1b G A 7: 121,914,261 C399Y probably damaging Het
Scp2 T C 4: 108,091,321 Y153C probably damaging Het
Sema3d A G 5: 12,497,603 K164R probably benign Het
Siglecf A G 7: 43,352,224 T153A probably benign Het
Siglecf A G 7: 43,355,543 N399S probably benign Het
Skint2 T C 4: 112,647,118 probably benign Het
Slc22a8 G A 19: 8,606,139 R236H probably damaging Het
Slc25a40 T A 5: 8,442,431 probably null Het
Slc26a5 T C 5: 21,816,958 D490G possibly damaging Het
Slc26a7 G T 4: 14,522,873 D482E probably benign Het
Smarca2 A T 19: 26,623,884 M77L probably benign Het
Sos2 A G 12: 69,617,363 L449P probably damaging Het
Spaca1 A G 4: 34,044,206 V96A probably damaging Het
Spata31d1b T A 13: 59,717,336 I766N possibly damaging Het
Specc1l T C 10: 75,309,859 Y1113H probably damaging Het
Speg A G 1: 75,389,005 R677G probably damaging Het
Taf5l A T 8: 123,997,990 D363E probably damaging Het
Tmem208 A G 8: 105,334,806 K155E possibly damaging Het
Tppp2 A C 14: 51,920,605 N169T probably benign Het
Trrap T A 5: 144,815,917 probably null Het
Ttll6 T A 11: 96,138,874 Y204* probably null Het
Ttn A T 2: 76,772,648 I18410K probably benign Het
V1rd19 T A 7: 24,003,724 V205D probably damaging Het
Vdac3 A T 8: 22,580,499 I132K possibly damaging Het
Vmn2r95 T G 17: 18,452,268 C756G probably damaging Het
Wdr63 T C 3: 146,083,046 Y260C probably damaging Het
Zc3h15 A G 2: 83,663,990 T421A unknown Het
Zc3hc1 T C 6: 30,374,838 T235A probably benign Het
Zcchc14 A G 8: 121,609,251 probably benign Het
Zfp318 T A 17: 46,411,440 N1456K possibly damaging Het
Zfp606 A G 7: 12,480,931 probably benign Het
Zfp811 T A 17: 32,797,425 H546L probably damaging Het
Zfp94 A T 7: 24,309,116 Y33N probably damaging Het
Zfyve9 G T 4: 108,682,295 probably benign Het
Other mutations in Clcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Clcn1 APN 6 42291703 missense probably damaging 1.00
IGL01732:Clcn1 APN 6 42310672 splice site probably benign
IGL02055:Clcn1 APN 6 42307555 missense probably damaging 1.00
IGL02507:Clcn1 APN 6 42307073 splice site probably benign
IGL02649:Clcn1 APN 6 42298829 missense probably damaging 1.00
IGL02739:Clcn1 APN 6 42286780 unclassified probably null
IGL03148:Clcn1 APN 6 42299991 critical splice donor site probably null
IGL03190:Clcn1 APN 6 42290103 missense probably benign 0.02
IGL03327:Clcn1 APN 6 42311219 missense probably benign 0.00
IGL03346:Clcn1 APN 6 42311219 missense probably benign 0.00
maimed UTSW 6 42298820 missense probably damaging 1.00
R0167:Clcn1 UTSW 6 42286836 missense probably damaging 1.00
R0323:Clcn1 UTSW 6 42310140 missense probably damaging 0.99
R0491:Clcn1 UTSW 6 42310581 missense probably benign
R0573:Clcn1 UTSW 6 42313045 splice site probably null
R0615:Clcn1 UTSW 6 42305575 missense probably damaging 1.00
R0944:Clcn1 UTSW 6 42313141 missense probably benign 0.00
R1562:Clcn1 UTSW 6 42300235 missense probably benign 0.29
R1566:Clcn1 UTSW 6 42291440 missense possibly damaging 0.58
R1692:Clcn1 UTSW 6 42313098 missense possibly damaging 0.67
R1728:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1729:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1772:Clcn1 UTSW 6 42294145 missense probably damaging 1.00
R1784:Clcn1 UTSW 6 42299514 missense possibly damaging 0.86
R1793:Clcn1 UTSW 6 42298926 critical splice donor site probably null
R1864:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R1865:Clcn1 UTSW 6 42305541 missense probably damaging 1.00
R2356:Clcn1 UTSW 6 42291625 missense probably damaging 1.00
R2403:Clcn1 UTSW 6 42313112 missense probably damaging 0.99
R2987:Clcn1 UTSW 6 42298850 missense probably damaging 1.00
R3082:Clcn1 UTSW 6 42290178 missense probably damaging 0.98
R3500:Clcn1 UTSW 6 42292995 missense probably damaging 0.99
R3747:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R3748:Clcn1 UTSW 6 42299915 missense probably damaging 1.00
R4041:Clcn1 UTSW 6 42309968 missense probably damaging 1.00
R4749:Clcn1 UTSW 6 42290197 splice site probably null
R4836:Clcn1 UTSW 6 42309964 missense probably damaging 0.96
R5021:Clcn1 UTSW 6 42310988 nonsense probably null
R5085:Clcn1 UTSW 6 42313880 missense probably benign 0.41
R5528:Clcn1 UTSW 6 42300341 missense probably benign 0.01
R5628:Clcn1 UTSW 6 42298889 missense probably damaging 0.96
R5678:Clcn1 UTSW 6 42307265 missense probably damaging 1.00
R5943:Clcn1 UTSW 6 42292966 missense probably damaging 1.00
R6053:Clcn1 UTSW 6 42300274 nonsense probably null
R6175:Clcn1 UTSW 6 42314162 missense probably damaging 1.00
R6394:Clcn1 UTSW 6 42307590 missense possibly damaging 0.84
R6394:Clcn1 UTSW 6 42313238 missense possibly damaging 0.82
R7012:Clcn1 UTSW 6 42290608 missense probably benign 0.01
R7020:Clcn1 UTSW 6 42298820 missense probably damaging 1.00
R7048:Clcn1 UTSW 6 42307543 missense probably damaging 1.00
R7212:Clcn1 UTSW 6 42291389 missense possibly damaging 0.46
R7225:Clcn1 UTSW 6 42293462 missense probably damaging 1.00
R7264:Clcn1 UTSW 6 42298838 missense probably damaging 1.00
R7636:Clcn1 UTSW 6 42291334 nonsense probably null
R7663:Clcn1 UTSW 6 42310063 missense possibly damaging 0.79
Z1088:Clcn1 UTSW 6 42300360 missense probably benign 0.40
Z1088:Clcn1 UTSW 6 42307256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGAGGGCCACACCAAATC -3'
(R):5'- ACACGTCCACTCTCTGACATG -3'

Sequencing Primer
(F):5'- CAAATCTGGGGTGCAGCTTC -3'
(R):5'- TGTTCACAGGATCAGCTCG -3'
Posted On2014-06-23