Incidental Mutation 'R1861:Dennd5b'
ID 203910
Institutional Source Beutler Lab
Gene Symbol Dennd5b
Ensembl Gene ENSMUSG00000030313
Gene Name DENN domain containing 5B
Synonyms D030011O10Rik, 9330160C06Rik
MMRRC Submission 039884-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R1861 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 148889569-149003178 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 148969760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 231 (N231I)
Ref Sequence ENSEMBL: ENSMUSP00000107182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111557] [ENSMUST00000127727] [ENSMUST00000145555]
AlphaFold A2RSQ0
Predicted Effect probably damaging
Transcript: ENSMUST00000111557
AA Change: N231I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107182
Gene: ENSMUSG00000030313
AA Change: N231I

DomainStartEndE-ValueType
uDENN 18 120 9.96e-39 SMART
low complexity region 145 161 N/A INTRINSIC
DENN 187 375 2.97e-78 SMART
dDENN 498 574 5.92e-23 SMART
RUN 866 929 2.13e-22 SMART
Pfam:PLAT 938 1043 1.7e-12 PFAM
low complexity region 1070 1081 N/A INTRINSIC
RUN 1205 1265 8.42e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121283
Predicted Effect probably benign
Transcript: ENSMUST00000127727
SMART Domains Protein: ENSMUSP00000123568
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 18 142 5.45e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145555
SMART Domains Protein: ENSMUSP00000127731
Gene: ENSMUSG00000030313

DomainStartEndE-ValueType
uDENN 1 42 3.03e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150436
Meta Mutation Damage Score 0.9039 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (117/121)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik C A 9: 89,034,884 (GRCm39) noncoding transcript Het
Abra C A 15: 41,732,430 (GRCm39) R212L probably damaging Het
Actr1a T C 19: 46,372,714 (GRCm39) E87G probably damaging Het
Adam26a A G 8: 44,022,578 (GRCm39) V304A possibly damaging Het
Alg2 T A 4: 47,471,670 (GRCm39) K379N probably benign Het
Alk G T 17: 72,181,933 (GRCm39) probably benign Het
Aopep A G 13: 63,163,597 (GRCm39) Y206C probably damaging Het
Arhgef17 A G 7: 100,531,475 (GRCm39) Y331H probably damaging Het
Art3 A G 5: 92,560,094 (GRCm39) probably benign Het
Asap1 G A 15: 64,007,647 (GRCm39) probably benign Het
Atad2 A T 15: 57,960,114 (GRCm39) probably null Het
Atp8b5 G A 4: 43,372,906 (GRCm39) R1150H probably damaging Het
Bltp2 C T 11: 78,178,755 (GRCm39) probably benign Het
Brdt T C 5: 107,507,324 (GRCm39) S575P probably benign Het
Capn3 T A 2: 120,316,963 (GRCm39) probably benign Het
Casd1 T A 6: 4,640,951 (GRCm39) Y691N probably damaging Het
Ccdc127 T G 13: 74,505,098 (GRCm39) H215Q possibly damaging Het
Cenpe T C 3: 134,974,740 (GRCm39) L2300P probably damaging Het
Clasp1 T C 1: 118,498,661 (GRCm39) F898L possibly damaging Het
Clcn1 C A 6: 42,290,925 (GRCm39) P933Q possibly damaging Het
Cntn3 T A 6: 102,222,032 (GRCm39) N489I probably benign Het
Col16a1 T C 4: 129,955,517 (GRCm39) probably benign Het
Col24a1 G A 3: 145,243,022 (GRCm39) probably null Het
Col8a2 C T 4: 126,205,417 (GRCm39) probably benign Het
Cpd T C 11: 76,675,208 (GRCm39) probably benign Het
Csmd3 A T 15: 47,522,588 (GRCm39) C2694S probably damaging Het
Cyp2c40 T C 19: 39,775,319 (GRCm39) Y311C probably benign Het
Dgkh T A 14: 78,816,232 (GRCm39) H936L probably benign Het
Dmtf1 T C 5: 9,170,347 (GRCm39) probably null Het
Dnai2 T C 11: 114,643,777 (GRCm39) V481A possibly damaging Het
Dnai3 T C 3: 145,788,801 (GRCm39) Y260C probably damaging Het
Dpyd T G 3: 118,710,780 (GRCm39) V396G probably damaging Het
Elmo3 A G 8: 106,035,213 (GRCm39) D448G probably damaging Het
Emsy A T 7: 98,290,822 (GRCm39) V100E probably damaging Het
Erbb2 T C 11: 98,303,563 (GRCm39) probably null Het
Faah T C 4: 115,865,432 (GRCm39) K85R probably benign Het
Fam149a A T 8: 45,792,399 (GRCm39) Y686* probably null Het
Fat4 T C 3: 39,064,633 (GRCm39) V4863A probably benign Het
Fbxl8 A G 8: 105,995,561 (GRCm39) T358A probably damaging Het
Fcgbpl1 A G 7: 27,854,157 (GRCm39) Y1707C probably damaging Het
Fgfr3 A G 5: 33,887,090 (GRCm39) T165A probably damaging Het
Fnbp1l A T 3: 122,354,581 (GRCm39) H180Q probably damaging Het
Gm8180 T A 14: 44,021,196 (GRCm39) H4L probably benign Het
Gon4l T C 3: 88,802,794 (GRCm39) V1135A probably damaging Het
Gstcd G T 3: 132,688,868 (GRCm39) N627K probably damaging Het
Gtf2a1l G A 17: 89,022,382 (GRCm39) V458I probably damaging Het
Gtf3c3 T C 1: 54,477,997 (GRCm39) E26G possibly damaging Het
Hrct1 A T 4: 43,727,404 (GRCm39) T15S probably benign Het
Ift122 C A 6: 115,868,889 (GRCm39) R459S probably damaging Het
Irf1 T A 11: 53,665,183 (GRCm39) C187S possibly damaging Het
Kcnh7 A G 2: 62,607,736 (GRCm39) V615A probably damaging Het
Kif1c T C 11: 70,594,168 (GRCm39) S61P probably damaging Het
Mamdc2 T C 19: 23,336,517 (GRCm39) T331A probably damaging Het
Mark2 T C 19: 7,268,128 (GRCm39) D25G possibly damaging Het
Me2 T C 18: 73,918,785 (GRCm39) D432G probably benign Het
Mfap3 T C 11: 57,419,032 (GRCm39) V64A probably benign Het
Nadk2 T A 15: 9,108,399 (GRCm39) M416K probably benign Het
Ndufs1 C T 1: 63,186,576 (GRCm39) G631D probably benign Het
Nomo1 G A 7: 45,727,525 (GRCm39) V1055I probably benign Het
Nuggc T A 14: 65,879,450 (GRCm39) probably benign Het
Nwd2 T C 5: 63,962,197 (GRCm39) S594P probably damaging Het
Or13c3 T A 4: 52,856,373 (GRCm39) I47L probably benign Het
Or4a27 T G 2: 88,559,674 (GRCm39) I90L probably damaging Het
Or4b1b C A 2: 90,112,502 (GRCm39) C139F probably damaging Het
Or5b113 T A 19: 13,342,705 (GRCm39) S238T possibly damaging Het
Or6p1 T C 1: 174,258,657 (GRCm39) I221T probably damaging Het
Or8c10 C T 9: 38,278,902 (GRCm39) S10L probably benign Het
Pakap A G 4: 57,709,468 (GRCm39) I138V probably damaging Het
Pcyt2 G A 11: 120,501,968 (GRCm39) P332S probably benign Het
Phaf1 A G 8: 105,966,703 (GRCm39) E150G probably null Het
Phf14 A T 6: 11,987,610 (GRCm39) M630L probably benign Het
Piezo1 T C 8: 123,222,489 (GRCm39) N919S possibly damaging Het
Pif1 A T 9: 65,496,735 (GRCm39) I283F probably damaging Het
Pknox2 G A 9: 36,834,957 (GRCm39) H171Y probably damaging Het
Pramel17 A T 4: 101,694,135 (GRCm39) D249E probably benign Het
Prkg2 T A 5: 99,095,275 (GRCm39) D632V probably damaging Het
Prr29 G A 11: 106,266,264 (GRCm39) A6T probably damaging Het
Rims1 T A 1: 22,635,639 (GRCm39) Y114F probably damaging Het
Ryr1 A T 7: 28,708,977 (GRCm39) D4796E unknown Het
Scnn1b G A 7: 121,513,484 (GRCm39) C399Y probably damaging Het
Scp2 T C 4: 107,948,518 (GRCm39) Y153C probably damaging Het
Sema3d A G 5: 12,547,570 (GRCm39) K164R probably benign Het
Siglecf A G 7: 43,001,648 (GRCm39) T153A probably benign Het
Siglecf A G 7: 43,004,967 (GRCm39) N399S probably benign Het
Skint2 T C 4: 112,504,315 (GRCm39) probably benign Het
Slc22a8 G A 19: 8,583,503 (GRCm39) R236H probably damaging Het
Slc25a40 T A 5: 8,492,431 (GRCm39) probably null Het
Slc26a5 T C 5: 22,021,956 (GRCm39) D490G possibly damaging Het
Slc26a7 G T 4: 14,522,873 (GRCm39) D482E probably benign Het
Smarca2 A T 19: 26,601,284 (GRCm39) M77L probably benign Het
Sos2 A G 12: 69,664,137 (GRCm39) L449P probably damaging Het
Spaca1 A G 4: 34,044,206 (GRCm39) V96A probably damaging Het
Spata31d1b T A 13: 59,865,150 (GRCm39) I766N possibly damaging Het
Specc1l T C 10: 75,145,693 (GRCm39) Y1113H probably damaging Het
Speg A G 1: 75,365,649 (GRCm39) R677G probably damaging Het
Taf5l A T 8: 124,724,729 (GRCm39) D363E probably damaging Het
Tex56 A T 13: 35,116,490 (GRCm39) I80F possibly damaging Het
Tmem208 A G 8: 106,061,438 (GRCm39) K155E possibly damaging Het
Tppp2 A C 14: 52,158,062 (GRCm39) N169T probably benign Het
Trrap T A 5: 144,752,727 (GRCm39) probably null Het
Ttll6 T A 11: 96,029,700 (GRCm39) Y204* probably null Het
Ttn A T 2: 76,602,992 (GRCm39) I18410K probably benign Het
V1rd19 T A 7: 23,703,149 (GRCm39) V205D probably damaging Het
Vdac3 A T 8: 23,070,515 (GRCm39) I132K possibly damaging Het
Vmn2r95 T G 17: 18,672,530 (GRCm39) C756G probably damaging Het
Zc3h15 A G 2: 83,494,334 (GRCm39) T421A unknown Het
Zc3hc1 T C 6: 30,374,837 (GRCm39) T235A probably benign Het
Zcchc14 A G 8: 122,335,990 (GRCm39) probably benign Het
Zfp318 T A 17: 46,722,366 (GRCm39) N1456K possibly damaging Het
Zfp606 A G 7: 12,214,858 (GRCm39) probably benign Het
Zfp811 T A 17: 33,016,399 (GRCm39) H546L probably damaging Het
Zfp94 A T 7: 24,008,541 (GRCm39) Y33N probably damaging Het
Zfyve9 G T 4: 108,539,492 (GRCm39) probably benign Het
Other mutations in Dennd5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Dennd5b APN 6 148,928,828 (GRCm39) missense probably damaging 1.00
IGL00590:Dennd5b APN 6 148,969,806 (GRCm39) missense probably benign 0.03
IGL00727:Dennd5b APN 6 148,908,214 (GRCm39) splice site probably benign
IGL00838:Dennd5b APN 6 148,906,861 (GRCm39) splice site probably benign
IGL01115:Dennd5b APN 6 148,911,246 (GRCm39) splice site probably benign
IGL01150:Dennd5b APN 6 148,969,583 (GRCm39) missense probably benign 0.01
IGL01873:Dennd5b APN 6 148,946,027 (GRCm39) missense probably benign
IGL01991:Dennd5b APN 6 148,982,322 (GRCm39) missense probably damaging 1.00
IGL02226:Dennd5b APN 6 148,934,799 (GRCm39) missense probably benign 0.00
IGL02820:Dennd5b APN 6 148,920,840 (GRCm39) missense probably null 0.51
IGL03056:Dennd5b APN 6 148,956,570 (GRCm39) missense probably damaging 1.00
IGL03085:Dennd5b APN 6 148,928,893 (GRCm39) missense probably damaging 1.00
IGL03329:Dennd5b APN 6 148,899,758 (GRCm39) missense possibly damaging 0.53
R0081:Dennd5b UTSW 6 148,895,257 (GRCm39) missense probably benign 0.13
R0617:Dennd5b UTSW 6 148,934,760 (GRCm39) splice site probably benign
R1241:Dennd5b UTSW 6 148,969,988 (GRCm39) missense probably benign 0.06
R1252:Dennd5b UTSW 6 148,945,985 (GRCm39) missense probably damaging 1.00
R1255:Dennd5b UTSW 6 148,943,148 (GRCm39) missense possibly damaging 0.48
R1641:Dennd5b UTSW 6 148,969,703 (GRCm39) missense probably damaging 1.00
R1674:Dennd5b UTSW 6 148,899,782 (GRCm39) missense probably damaging 1.00
R1781:Dennd5b UTSW 6 148,928,896 (GRCm39) missense probably damaging 1.00
R1907:Dennd5b UTSW 6 148,943,074 (GRCm39) missense probably benign 0.00
R2412:Dennd5b UTSW 6 148,906,736 (GRCm39) missense possibly damaging 0.88
R3794:Dennd5b UTSW 6 149,002,715 (GRCm39) missense possibly damaging 0.87
R3825:Dennd5b UTSW 6 148,946,334 (GRCm39) missense probably benign
R4581:Dennd5b UTSW 6 148,918,482 (GRCm39) splice site silent
R4654:Dennd5b UTSW 6 148,908,335 (GRCm39) missense probably damaging 1.00
R4725:Dennd5b UTSW 6 148,946,277 (GRCm39) missense probably damaging 0.97
R4981:Dennd5b UTSW 6 148,911,270 (GRCm39) missense possibly damaging 0.88
R4994:Dennd5b UTSW 6 148,942,998 (GRCm39) splice site probably null
R5400:Dennd5b UTSW 6 148,901,514 (GRCm39) missense probably damaging 1.00
R5452:Dennd5b UTSW 6 148,943,011 (GRCm39) splice site probably null
R5548:Dennd5b UTSW 6 148,920,847 (GRCm39) splice site probably null
R5841:Dennd5b UTSW 6 148,946,253 (GRCm39) missense probably benign 0.11
R5996:Dennd5b UTSW 6 148,969,593 (GRCm39) missense probably benign 0.22
R6082:Dennd5b UTSW 6 148,970,193 (GRCm39) missense probably damaging 0.99
R6556:Dennd5b UTSW 6 148,915,749 (GRCm39) splice site probably null
R6812:Dennd5b UTSW 6 148,982,630 (GRCm39) start gained probably benign
R6828:Dennd5b UTSW 6 148,895,244 (GRCm39) missense probably damaging 0.99
R7104:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7231:Dennd5b UTSW 6 148,946,102 (GRCm39) missense probably damaging 1.00
R7325:Dennd5b UTSW 6 148,922,068 (GRCm39) missense probably benign 0.00
R7399:Dennd5b UTSW 6 148,937,981 (GRCm39) missense probably damaging 1.00
R7516:Dennd5b UTSW 6 148,969,878 (GRCm39) missense probably benign 0.02
R7751:Dennd5b UTSW 6 148,918,604 (GRCm39) missense probably benign 0.01
R7763:Dennd5b UTSW 6 148,970,156 (GRCm39) missense probably damaging 1.00
R7770:Dennd5b UTSW 6 148,943,214 (GRCm39) missense probably damaging 0.99
R7788:Dennd5b UTSW 6 148,970,064 (GRCm39) missense probably benign 0.00
R7854:Dennd5b UTSW 6 148,969,964 (GRCm39) missense probably benign 0.00
R7899:Dennd5b UTSW 6 148,943,159 (GRCm39) missense probably damaging 1.00
R8226:Dennd5b UTSW 6 148,915,746 (GRCm39) splice site probably null
R8328:Dennd5b UTSW 6 148,922,115 (GRCm39) missense probably damaging 1.00
R8489:Dennd5b UTSW 6 148,986,389 (GRCm39) missense probably benign 0.00
R8517:Dennd5b UTSW 6 148,930,619 (GRCm39) missense probably damaging 1.00
R8556:Dennd5b UTSW 6 148,895,268 (GRCm39) missense probably damaging 1.00
R8693:Dennd5b UTSW 6 148,911,272 (GRCm39) nonsense probably null
R8946:Dennd5b UTSW 6 148,943,485 (GRCm39) intron probably benign
R8966:Dennd5b UTSW 6 148,901,474 (GRCm39) missense probably damaging 1.00
R9122:Dennd5b UTSW 6 148,908,240 (GRCm39) missense
R9178:Dennd5b UTSW 6 148,934,844 (GRCm39) nonsense probably null
R9208:Dennd5b UTSW 6 149,002,698 (GRCm39) missense probably benign 0.09
R9465:Dennd5b UTSW 6 148,908,260 (GRCm39) missense probably damaging 1.00
R9535:Dennd5b UTSW 6 148,895,365 (GRCm39) missense probably benign 0.03
R9541:Dennd5b UTSW 6 148,899,872 (GRCm39) missense probably benign 0.00
R9731:Dennd5b UTSW 6 148,970,138 (GRCm39) missense probably damaging 1.00
R9760:Dennd5b UTSW 6 148,969,997 (GRCm39) missense probably benign 0.14
R9783:Dennd5b UTSW 6 148,911,342 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACACAGGTGAACACTTGC -3'
(R):5'- CTGGCAAGTAGTATTGACGAGG -3'

Sequencing Primer
(F):5'- CAGGTGAACACTTGCACTAGGTTC -3'
(R):5'- GGGAGATGCAACCTCTCTTTTGAAAC -3'
Posted On 2014-06-23