Incidental Mutation 'R1861:Specc1l'
ID 203936
Institutional Source Beutler Lab
Gene Symbol Specc1l
Ensembl Gene ENSMUSG00000033444
Gene Name sperm antigen with calponin homology and coiled-coil domains 1-like
Synonyms 9530057A13Rik, Specc1l, 4932439K10Rik, 4930470P14Rik, Cytsa
MMRRC Submission 039884-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.553) question?
Stock # R1861 (G1)
Quality Score 222
Status Validated
Chromosome 10
Chromosomal Location 75047872-75148234 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75145693 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 1113 (Y1113H)
Ref Sequence ENSEMBL: ENSMUSP00000151322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040105] [ENSMUST00000105421] [ENSMUST00000218766]
AlphaFold Q2KN98
Predicted Effect probably damaging
Transcript: ENSMUST00000040105
AA Change: Y1130H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045099
Gene: ENSMUSG00000033444
AA Change: Y1130H

DomainStartEndE-ValueType
low complexity region 97 107 N/A INTRINSIC
low complexity region 135 149 N/A INTRINSIC
coiled coil region 255 298 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
coiled coil region 412 467 N/A INTRINSIC
coiled coil region 505 825 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
low complexity region 989 1010 N/A INTRINSIC
CH 1031 1129 1.52e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105421
AA Change: Y1130H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101061
Gene: ENSMUSG00000033444
AA Change: Y1130H

DomainStartEndE-ValueType
low complexity region 80 90 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
coiled coil region 238 281 N/A INTRINSIC
low complexity region 359 373 N/A INTRINSIC
coiled coil region 395 450 N/A INTRINSIC
coiled coil region 488 808 N/A INTRINSIC
low complexity region 829 841 N/A INTRINSIC
low complexity region 972 993 N/A INTRINSIC
CH 1014 1112 1.52e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218644
Predicted Effect probably damaging
Transcript: ENSMUST00000218766
AA Change: Y1113H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8664 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein. The encoded protein may play a critical role in actin-cytoskeletal reorganization during facial morphogenesis. Mutations in this gene are a cause of oblique facial clefting-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. A read-through transcript composed of SPECC1L (sperm antigen with calponin homology and coiled-coil domains 1-like) and the downstream ADORA2A (adenosine A2a receptor) gene sequence has been identified, but it is thought to be non-coding. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous knockout affects cranial neural crest cell migration, which causes neural tube closure defects and leads to embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik C A 9: 89,034,884 (GRCm39) noncoding transcript Het
Abra C A 15: 41,732,430 (GRCm39) R212L probably damaging Het
Actr1a T C 19: 46,372,714 (GRCm39) E87G probably damaging Het
Adam26a A G 8: 44,022,578 (GRCm39) V304A possibly damaging Het
Alg2 T A 4: 47,471,670 (GRCm39) K379N probably benign Het
Alk G T 17: 72,181,933 (GRCm39) probably benign Het
Aopep A G 13: 63,163,597 (GRCm39) Y206C probably damaging Het
Arhgef17 A G 7: 100,531,475 (GRCm39) Y331H probably damaging Het
Art3 A G 5: 92,560,094 (GRCm39) probably benign Het
Asap1 G A 15: 64,007,647 (GRCm39) probably benign Het
Atad2 A T 15: 57,960,114 (GRCm39) probably null Het
Atp8b5 G A 4: 43,372,906 (GRCm39) R1150H probably damaging Het
Bltp2 C T 11: 78,178,755 (GRCm39) probably benign Het
Brdt T C 5: 107,507,324 (GRCm39) S575P probably benign Het
Capn3 T A 2: 120,316,963 (GRCm39) probably benign Het
Casd1 T A 6: 4,640,951 (GRCm39) Y691N probably damaging Het
Ccdc127 T G 13: 74,505,098 (GRCm39) H215Q possibly damaging Het
Cenpe T C 3: 134,974,740 (GRCm39) L2300P probably damaging Het
Clasp1 T C 1: 118,498,661 (GRCm39) F898L possibly damaging Het
Clcn1 C A 6: 42,290,925 (GRCm39) P933Q possibly damaging Het
Cntn3 T A 6: 102,222,032 (GRCm39) N489I probably benign Het
Col16a1 T C 4: 129,955,517 (GRCm39) probably benign Het
Col24a1 G A 3: 145,243,022 (GRCm39) probably null Het
Col8a2 C T 4: 126,205,417 (GRCm39) probably benign Het
Cpd T C 11: 76,675,208 (GRCm39) probably benign Het
Csmd3 A T 15: 47,522,588 (GRCm39) C2694S probably damaging Het
Cyp2c40 T C 19: 39,775,319 (GRCm39) Y311C probably benign Het
Dennd5b T A 6: 148,969,760 (GRCm39) N231I probably damaging Het
Dgkh T A 14: 78,816,232 (GRCm39) H936L probably benign Het
Dmtf1 T C 5: 9,170,347 (GRCm39) probably null Het
Dnai2 T C 11: 114,643,777 (GRCm39) V481A possibly damaging Het
Dnai3 T C 3: 145,788,801 (GRCm39) Y260C probably damaging Het
Dpyd T G 3: 118,710,780 (GRCm39) V396G probably damaging Het
Elmo3 A G 8: 106,035,213 (GRCm39) D448G probably damaging Het
Emsy A T 7: 98,290,822 (GRCm39) V100E probably damaging Het
Erbb2 T C 11: 98,303,563 (GRCm39) probably null Het
Faah T C 4: 115,865,432 (GRCm39) K85R probably benign Het
Fam149a A T 8: 45,792,399 (GRCm39) Y686* probably null Het
Fat4 T C 3: 39,064,633 (GRCm39) V4863A probably benign Het
Fbxl8 A G 8: 105,995,561 (GRCm39) T358A probably damaging Het
Fcgbpl1 A G 7: 27,854,157 (GRCm39) Y1707C probably damaging Het
Fgfr3 A G 5: 33,887,090 (GRCm39) T165A probably damaging Het
Fnbp1l A T 3: 122,354,581 (GRCm39) H180Q probably damaging Het
Gm8180 T A 14: 44,021,196 (GRCm39) H4L probably benign Het
Gon4l T C 3: 88,802,794 (GRCm39) V1135A probably damaging Het
Gstcd G T 3: 132,688,868 (GRCm39) N627K probably damaging Het
Gtf2a1l G A 17: 89,022,382 (GRCm39) V458I probably damaging Het
Gtf3c3 T C 1: 54,477,997 (GRCm39) E26G possibly damaging Het
Hrct1 A T 4: 43,727,404 (GRCm39) T15S probably benign Het
Ift122 C A 6: 115,868,889 (GRCm39) R459S probably damaging Het
Irf1 T A 11: 53,665,183 (GRCm39) C187S possibly damaging Het
Kcnh7 A G 2: 62,607,736 (GRCm39) V615A probably damaging Het
Kif1c T C 11: 70,594,168 (GRCm39) S61P probably damaging Het
Mamdc2 T C 19: 23,336,517 (GRCm39) T331A probably damaging Het
Mark2 T C 19: 7,268,128 (GRCm39) D25G possibly damaging Het
Me2 T C 18: 73,918,785 (GRCm39) D432G probably benign Het
Mfap3 T C 11: 57,419,032 (GRCm39) V64A probably benign Het
Nadk2 T A 15: 9,108,399 (GRCm39) M416K probably benign Het
Ndufs1 C T 1: 63,186,576 (GRCm39) G631D probably benign Het
Nomo1 G A 7: 45,727,525 (GRCm39) V1055I probably benign Het
Nuggc T A 14: 65,879,450 (GRCm39) probably benign Het
Nwd2 T C 5: 63,962,197 (GRCm39) S594P probably damaging Het
Or13c3 T A 4: 52,856,373 (GRCm39) I47L probably benign Het
Or4a27 T G 2: 88,559,674 (GRCm39) I90L probably damaging Het
Or4b1b C A 2: 90,112,502 (GRCm39) C139F probably damaging Het
Or5b113 T A 19: 13,342,705 (GRCm39) S238T possibly damaging Het
Or6p1 T C 1: 174,258,657 (GRCm39) I221T probably damaging Het
Or8c10 C T 9: 38,278,902 (GRCm39) S10L probably benign Het
Pakap A G 4: 57,709,468 (GRCm39) I138V probably damaging Het
Pcyt2 G A 11: 120,501,968 (GRCm39) P332S probably benign Het
Phaf1 A G 8: 105,966,703 (GRCm39) E150G probably null Het
Phf14 A T 6: 11,987,610 (GRCm39) M630L probably benign Het
Piezo1 T C 8: 123,222,489 (GRCm39) N919S possibly damaging Het
Pif1 A T 9: 65,496,735 (GRCm39) I283F probably damaging Het
Pknox2 G A 9: 36,834,957 (GRCm39) H171Y probably damaging Het
Pramel17 A T 4: 101,694,135 (GRCm39) D249E probably benign Het
Prkg2 T A 5: 99,095,275 (GRCm39) D632V probably damaging Het
Prr29 G A 11: 106,266,264 (GRCm39) A6T probably damaging Het
Rims1 T A 1: 22,635,639 (GRCm39) Y114F probably damaging Het
Ryr1 A T 7: 28,708,977 (GRCm39) D4796E unknown Het
Scnn1b G A 7: 121,513,484 (GRCm39) C399Y probably damaging Het
Scp2 T C 4: 107,948,518 (GRCm39) Y153C probably damaging Het
Sema3d A G 5: 12,547,570 (GRCm39) K164R probably benign Het
Siglecf A G 7: 43,004,967 (GRCm39) N399S probably benign Het
Siglecf A G 7: 43,001,648 (GRCm39) T153A probably benign Het
Skint2 T C 4: 112,504,315 (GRCm39) probably benign Het
Slc22a8 G A 19: 8,583,503 (GRCm39) R236H probably damaging Het
Slc25a40 T A 5: 8,492,431 (GRCm39) probably null Het
Slc26a5 T C 5: 22,021,956 (GRCm39) D490G possibly damaging Het
Slc26a7 G T 4: 14,522,873 (GRCm39) D482E probably benign Het
Smarca2 A T 19: 26,601,284 (GRCm39) M77L probably benign Het
Sos2 A G 12: 69,664,137 (GRCm39) L449P probably damaging Het
Spaca1 A G 4: 34,044,206 (GRCm39) V96A probably damaging Het
Spata31d1b T A 13: 59,865,150 (GRCm39) I766N possibly damaging Het
Speg A G 1: 75,365,649 (GRCm39) R677G probably damaging Het
Taf5l A T 8: 124,724,729 (GRCm39) D363E probably damaging Het
Tex56 A T 13: 35,116,490 (GRCm39) I80F possibly damaging Het
Tmem208 A G 8: 106,061,438 (GRCm39) K155E possibly damaging Het
Tppp2 A C 14: 52,158,062 (GRCm39) N169T probably benign Het
Trrap T A 5: 144,752,727 (GRCm39) probably null Het
Ttll6 T A 11: 96,029,700 (GRCm39) Y204* probably null Het
Ttn A T 2: 76,602,992 (GRCm39) I18410K probably benign Het
V1rd19 T A 7: 23,703,149 (GRCm39) V205D probably damaging Het
Vdac3 A T 8: 23,070,515 (GRCm39) I132K possibly damaging Het
Vmn2r95 T G 17: 18,672,530 (GRCm39) C756G probably damaging Het
Zc3h15 A G 2: 83,494,334 (GRCm39) T421A unknown Het
Zc3hc1 T C 6: 30,374,837 (GRCm39) T235A probably benign Het
Zcchc14 A G 8: 122,335,990 (GRCm39) probably benign Het
Zfp318 T A 17: 46,722,366 (GRCm39) N1456K possibly damaging Het
Zfp606 A G 7: 12,214,858 (GRCm39) probably benign Het
Zfp811 T A 17: 33,016,399 (GRCm39) H546L probably damaging Het
Zfp94 A T 7: 24,008,541 (GRCm39) Y33N probably damaging Het
Zfyve9 G T 4: 108,539,492 (GRCm39) probably benign Het
Other mutations in Specc1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00549:Specc1l APN 10 75,082,055 (GRCm39) missense probably benign 0.12
IGL01638:Specc1l APN 10 75,082,039 (GRCm39) nonsense probably null
IGL01970:Specc1l APN 10 75,081,595 (GRCm39) missense probably damaging 1.00
IGL02539:Specc1l APN 10 75,103,342 (GRCm39) missense probably benign 0.39
IGL02737:Specc1l APN 10 75,082,158 (GRCm39) missense probably damaging 0.99
IGL02941:Specc1l APN 10 75,077,022 (GRCm39) missense probably benign 0.10
R0305:Specc1l UTSW 10 75,081,663 (GRCm39) missense probably damaging 1.00
R0374:Specc1l UTSW 10 75,084,293 (GRCm39) missense probably damaging 0.99
R0402:Specc1l UTSW 10 75,082,260 (GRCm39) missense probably damaging 1.00
R1456:Specc1l UTSW 10 75,082,118 (GRCm39) missense probably damaging 0.98
R1508:Specc1l UTSW 10 75,143,072 (GRCm39) missense probably benign 0.00
R1869:Specc1l UTSW 10 75,097,659 (GRCm39) missense probably damaging 1.00
R1929:Specc1l UTSW 10 75,081,438 (GRCm39) missense probably damaging 1.00
R1930:Specc1l UTSW 10 75,145,658 (GRCm39) missense probably damaging 1.00
R2021:Specc1l UTSW 10 75,103,425 (GRCm39) critical splice donor site probably null
R2209:Specc1l UTSW 10 75,082,410 (GRCm39) missense probably damaging 1.00
R2271:Specc1l UTSW 10 75,081,438 (GRCm39) missense probably damaging 1.00
R2937:Specc1l UTSW 10 75,094,965 (GRCm39) missense probably damaging 0.98
R4415:Specc1l UTSW 10 75,082,162 (GRCm39) missense possibly damaging 0.92
R4758:Specc1l UTSW 10 75,082,182 (GRCm39) missense probably damaging 0.99
R5344:Specc1l UTSW 10 75,082,007 (GRCm39) missense possibly damaging 0.84
R5383:Specc1l UTSW 10 75,082,539 (GRCm39) missense possibly damaging 0.86
R5426:Specc1l UTSW 10 75,103,384 (GRCm39) missense probably benign 0.21
R5774:Specc1l UTSW 10 75,081,234 (GRCm39) missense probably damaging 1.00
R5788:Specc1l UTSW 10 75,112,755 (GRCm39) missense probably damaging 1.00
R6101:Specc1l UTSW 10 75,084,466 (GRCm39) missense probably damaging 1.00
R6105:Specc1l UTSW 10 75,084,466 (GRCm39) missense probably damaging 1.00
R6136:Specc1l UTSW 10 75,082,494 (GRCm39) missense probably benign 0.38
R6345:Specc1l UTSW 10 75,084,322 (GRCm39) missense probably damaging 0.99
R6459:Specc1l UTSW 10 75,082,001 (GRCm39) missense probably damaging 1.00
R6641:Specc1l UTSW 10 75,082,383 (GRCm39) missense probably damaging 1.00
R6996:Specc1l UTSW 10 75,082,113 (GRCm39) missense probably benign 0.23
R7100:Specc1l UTSW 10 75,081,329 (GRCm39) missense probably benign 0.21
R7475:Specc1l UTSW 10 75,082,281 (GRCm39) missense possibly damaging 0.59
R7545:Specc1l UTSW 10 75,080,921 (GRCm39) missense probably benign 0.00
R7615:Specc1l UTSW 10 75,099,120 (GRCm39) missense probably benign 0.02
R7635:Specc1l UTSW 10 75,112,638 (GRCm39) missense probably damaging 1.00
R7640:Specc1l UTSW 10 75,093,703 (GRCm39) missense probably damaging 1.00
R7682:Specc1l UTSW 10 75,081,636 (GRCm39) missense probably damaging 0.99
R7711:Specc1l UTSW 10 75,066,642 (GRCm39) missense probably benign 0.02
R7742:Specc1l UTSW 10 75,082,251 (GRCm39) missense probably benign 0.01
R7847:Specc1l UTSW 10 75,145,670 (GRCm39) missense probably damaging 0.99
R8015:Specc1l UTSW 10 75,076,902 (GRCm39) missense probably benign 0.17
R8030:Specc1l UTSW 10 75,084,389 (GRCm39) missense probably damaging 1.00
R8882:Specc1l UTSW 10 75,065,689 (GRCm39) start codon destroyed unknown
R9069:Specc1l UTSW 10 75,066,640 (GRCm39) missense probably benign 0.03
R9790:Specc1l UTSW 10 75,066,603 (GRCm39) missense probably benign 0.21
R9791:Specc1l UTSW 10 75,066,603 (GRCm39) missense probably benign 0.21
X0021:Specc1l UTSW 10 75,109,874 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAAAGAGGCAGTGCACCTTAG -3'
(R):5'- CTGTACTTCTGCTCCTGAGG -3'

Sequencing Primer
(F):5'- GTGCACCTTAGACTAAAAGCTGTC -3'
(R):5'- TTCTGCTCCTGAGGACGGC -3'
Posted On 2014-06-23