Incidental Mutation 'R0110:Pcdh15'
ID20395
Institutional Source Beutler Lab
Gene Symbol Pcdh15
Ensembl Gene ENSMUSG00000052613
Gene Nameprotocadherin 15
SynonymsGm9815, nmf19, Ush1f
MMRRC Submission 038396-MU
Accession Numbers

Genbank: NM_023115; Ensembl: ENSMUST00000105425

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0110 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location73099342-74649737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74290976 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 296 (N296Y)
Ref Sequence ENSEMBL: ENSMUSP00000142238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064562] [ENSMUST00000092420] [ENSMUST00000105424] [ENSMUST00000105426] [ENSMUST00000105429] [ENSMUST00000124046] [ENSMUST00000125006] [ENSMUST00000125055] [ENSMUST00000125517] [ENSMUST00000126920] [ENSMUST00000129404] [ENSMUST00000131321] [ENSMUST00000131724] [ENSMUST00000134009] [ENSMUST00000136096] [ENSMUST00000144302] [ENSMUST00000146682] [ENSMUST00000147189] [ENSMUST00000149977] [ENSMUST00000151116] [ENSMUST00000152655] [ENSMUST00000152819] [ENSMUST00000155701] [ENSMUST00000177107] [ENSMUST00000177420] [ENSMUST00000191709] [ENSMUST00000191854] [ENSMUST00000193174] [ENSMUST00000193361] [ENSMUST00000193739] [ENSMUST00000195531]
Predicted Effect probably damaging
Transcript: ENSMUST00000064562
AA Change: N296Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000068561
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 644 2.34e-16 SMART
CA 668 746 1.93e-26 SMART
CA 770 853 5.69e-15 SMART
CA 877 963 6.85e-9 SMART
CA 984 1071 3.09e-16 SMART
CA 1095 1179 4.49e-4 SMART
transmembrane domain 1304 1326 N/A INTRINSIC
low complexity region 1347 1374 N/A INTRINSIC
low complexity region 1583 1600 N/A INTRINSIC
low complexity region 1662 1682 N/A INTRINSIC
low complexity region 1689 1702 N/A INTRINSIC
low complexity region 1706 1756 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000092420
AA Change: N296Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090076
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1377 1399 N/A INTRINSIC
low complexity region 1415 1442 N/A INTRINSIC
low complexity region 1651 1668 N/A INTRINSIC
low complexity region 1730 1750 N/A INTRINSIC
low complexity region 1757 1770 N/A INTRINSIC
low complexity region 1774 1824 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105424
AA Change: N296Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101064
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1656 1673 N/A INTRINSIC
low complexity region 1735 1755 N/A INTRINSIC
low complexity region 1762 1775 N/A INTRINSIC
low complexity region 1779 1829 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105426
AA Change: N296Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101066
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1661 1678 N/A INTRINSIC
low complexity region 1740 1760 N/A INTRINSIC
low complexity region 1767 1780 N/A INTRINSIC
low complexity region 1784 1834 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105429
AA Change: N296Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101069
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 644 2.34e-16 SMART
CA 668 746 1.93e-26 SMART
CA 770 853 5.69e-15 SMART
CA 877 963 6.85e-9 SMART
CA 984 1071 3.09e-16 SMART
CA 1095 1179 4.49e-4 SMART
transmembrane domain 1304 1326 N/A INTRINSIC
low complexity region 1347 1374 N/A INTRINSIC
low complexity region 1585 1602 N/A INTRINSIC
low complexity region 1664 1684 N/A INTRINSIC
low complexity region 1691 1704 N/A INTRINSIC
low complexity region 1708 1758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123398
Predicted Effect probably benign
Transcript: ENSMUST00000124046
SMART Domains Protein: ENSMUSP00000121130
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
CA 30 118 7.87e-9 SMART
CA 142 224 4.88e-14 SMART
CA 249 326 4.65e-20 SMART
CA 350 428 1.93e-26 SMART
CA 452 535 5.69e-15 SMART
CA 559 645 6.85e-9 SMART
CA 666 753 3.09e-16 SMART
CA 777 861 4.49e-4 SMART
transmembrane domain 986 1008 N/A INTRINSIC
low complexity region 1029 1056 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125006
AA Change: N296Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120056
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1122 4.52e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125055
AA Change: N296Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114326
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
low complexity region 649 665 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125517
AA Change: N296Y

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115399
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
low complexity region 430 468 N/A INTRINSIC
low complexity region 521 584 N/A INTRINSIC
low complexity region 610 641 N/A INTRINSIC
low complexity region 657 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126920
AA Change: N274Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121939
Gene: ENSMUSG00000052613
AA Change: N274Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 42 123 1.22e-1 SMART
CA 152 241 5.48e-8 SMART
CA 282 371 1.94e-8 SMART
CA 404 485 2.29e-10 SMART
CA 509 591 4.88e-14 SMART
CA 616 693 4.65e-20 SMART
CA 717 795 1.93e-26 SMART
CA 819 902 5.69e-15 SMART
CA 926 1012 6.85e-9 SMART
CA 1033 1120 3.09e-16 SMART
CA 1144 1228 4.49e-4 SMART
transmembrane domain 1353 1375 N/A INTRINSIC
low complexity region 1396 1423 N/A INTRINSIC
low complexity region 1634 1651 N/A INTRINSIC
low complexity region 1713 1733 N/A INTRINSIC
low complexity region 1740 1753 N/A INTRINSIC
low complexity region 1757 1807 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129404
AA Change: N274Y

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000117731
Gene: ENSMUSG00000052613
AA Change: N274Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 42 123 1.22e-1 SMART
CA 152 241 5.48e-8 SMART
CA 282 371 1.94e-8 SMART
CA 404 485 2.29e-10 SMART
CA 509 591 4.88e-14 SMART
CA 616 693 4.65e-20 SMART
CA 717 795 1.93e-26 SMART
CA 819 902 5.69e-15 SMART
CA 926 1012 6.85e-9 SMART
CA 1033 1120 3.09e-16 SMART
CA 1144 1228 4.49e-4 SMART
transmembrane domain 1355 1377 N/A INTRINSIC
low complexity region 1393 1420 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1710 1730 N/A INTRINSIC
low complexity region 1737 1750 N/A INTRINSIC
low complexity region 1754 1804 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131321
AA Change: N296Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122911
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1654 1671 N/A INTRINSIC
low complexity region 1733 1753 N/A INTRINSIC
low complexity region 1760 1773 N/A INTRINSIC
low complexity region 1777 1827 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131724
AA Change: N296Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122466
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134009
AA Change: N296Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120618
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 513 2.52e-7 SMART
CA 534 601 4.52e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136096
AA Change: N296Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121534
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
low complexity region 649 665 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144302
SMART Domains Protein: ENSMUSP00000122606
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
low complexity region 313 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146682
SMART Domains Protein: ENSMUSP00000134863
Gene: ENSMUSG00000052613

DomainStartEndE-ValueType
transmembrane domain 128 150 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147189
AA Change: N259Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122940
Gene: ENSMUSG00000052613
AA Change: N259Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
low complexity region 209 225 N/A INTRINSIC
CA 267 356 1.94e-8 SMART
CA 389 470 2.29e-10 SMART
CA 494 576 4.88e-14 SMART
CA 601 678 4.65e-20 SMART
CA 702 780 1.93e-26 SMART
CA 804 887 5.69e-15 SMART
CA 911 997 6.85e-9 SMART
CA 1018 1105 3.09e-16 SMART
CA 1129 1213 4.49e-4 SMART
transmembrane domain 1340 1362 N/A INTRINSIC
low complexity region 1378 1405 N/A INTRINSIC
low complexity region 1614 1631 N/A INTRINSIC
low complexity region 1693 1713 N/A INTRINSIC
low complexity region 1720 1733 N/A INTRINSIC
low complexity region 1737 1787 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149977
AA Change: N296Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118833
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151116
AA Change: N301Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119662
Gene: ENSMUSG00000052613
AA Change: N301Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 519 7.87e-9 SMART
CA 543 625 4.88e-14 SMART
CA 650 727 4.65e-20 SMART
CA 751 829 1.93e-26 SMART
CA 853 936 5.69e-15 SMART
CA 960 1046 6.85e-9 SMART
CA 1067 1154 3.09e-16 SMART
CA 1178 1262 4.49e-4 SMART
transmembrane domain 1387 1409 N/A INTRINSIC
low complexity region 1430 1457 N/A INTRINSIC
low complexity region 1489 1519 N/A INTRINSIC
low complexity region 1521 1539 N/A INTRINSIC
low complexity region 1592 1655 N/A INTRINSIC
low complexity region 1681 1712 N/A INTRINSIC
low complexity region 1728 1756 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152655
AA Change: N296Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118201
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 507 1.2e-12 SMART
CA 531 613 2.3e-16 SMART
CA 638 726 3.4e-6 SMART
low complexity region 783 846 N/A INTRINSIC
low complexity region 872 903 N/A INTRINSIC
low complexity region 919 947 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152819
AA Change: N296Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123647
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
Blast:CA 304 363 1e-33 BLAST
low complexity region 364 399 N/A INTRINSIC
low complexity region 452 515 N/A INTRINSIC
low complexity region 541 572 N/A INTRINSIC
low complexity region 588 616 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155701
AA Change: N296Y

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135495
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
Blast:CA 304 330 2e-8 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000177107
AA Change: N301Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135501
Gene: ENSMUSG00000052613
AA Change: N301Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1482 1499 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177420
AA Change: N301Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135849
Gene: ENSMUSG00000052613
AA Change: N301Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1127 4.52e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191709
AA Change: N301Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142313
Gene: ENSMUSG00000052613
AA Change: N301Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1480 1510 N/A INTRINSIC
low complexity region 1512 1530 N/A INTRINSIC
low complexity region 1583 1646 N/A INTRINSIC
low complexity region 1672 1703 N/A INTRINSIC
low complexity region 1719 1747 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191854
AA Change: N296Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141973
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 1.22e-1 SMART
CA 174 263 5.48e-8 SMART
CA 304 393 1.94e-8 SMART
CA 426 507 2.29e-10 SMART
CA 531 613 4.88e-14 SMART
CA 638 715 4.65e-20 SMART
CA 739 817 1.93e-26 SMART
CA 841 924 5.69e-15 SMART
CA 948 1034 6.85e-9 SMART
CA 1055 1142 3.09e-16 SMART
CA 1166 1250 4.49e-4 SMART
transmembrane domain 1375 1397 N/A INTRINSIC
low complexity region 1418 1445 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193174
AA Change: N296Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142238
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 514 3.8e-11 SMART
CA 538 620 2.3e-16 SMART
CA 645 722 2.3e-22 SMART
CA 746 824 9.3e-29 SMART
CA 848 931 2.8e-17 SMART
CA 955 1041 3.3e-11 SMART
CA 1062 1149 1.5e-18 SMART
CA 1173 1257 2.3e-6 SMART
transmembrane domain 1382 1404 N/A INTRINSIC
low complexity region 1425 1452 N/A INTRINSIC
low complexity region 1482 1512 N/A INTRINSIC
low complexity region 1514 1532 N/A INTRINSIC
low complexity region 1585 1648 N/A INTRINSIC
low complexity region 1674 1705 N/A INTRINSIC
low complexity region 1721 1749 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193361
AA Change: N301Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141792
Gene: ENSMUSG00000052613
AA Change: N301Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1380 1402 N/A INTRINSIC
low complexity region 1423 1450 N/A INTRINSIC
low complexity region 1661 1678 N/A INTRINSIC
low complexity region 1740 1760 N/A INTRINSIC
low complexity region 1767 1780 N/A INTRINSIC
low complexity region 1784 1834 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193739
AA Change: N301Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142173
Gene: ENSMUSG00000052613
AA Change: N301Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 69 150 1.22e-1 SMART
CA 179 268 5.48e-8 SMART
CA 309 398 1.94e-8 SMART
CA 431 512 2.29e-10 SMART
CA 536 618 4.88e-14 SMART
CA 643 720 4.65e-20 SMART
CA 744 822 1.93e-26 SMART
CA 846 929 5.69e-15 SMART
CA 953 1039 6.85e-9 SMART
CA 1060 1147 3.09e-16 SMART
CA 1171 1255 4.49e-4 SMART
transmembrane domain 1382 1404 N/A INTRINSIC
low complexity region 1420 1447 N/A INTRINSIC
low complexity region 1477 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000195531
AA Change: N296Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141920
Gene: ENSMUSG00000052613
AA Change: N296Y

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 64 145 6e-4 SMART
CA 174 263 2.8e-10 SMART
CA 304 393 9.4e-11 SMART
CA 426 507 1.2e-12 SMART
CA 531 613 2.3e-16 SMART
CA 638 715 2.3e-22 SMART
CA 739 817 9.3e-29 SMART
CA 841 924 2.8e-17 SMART
CA 948 1034 3.3e-11 SMART
CA 1055 1142 1.5e-18 SMART
CA 1166 1250 2.3e-6 SMART
transmembrane domain 1377 1399 N/A INTRINSIC
low complexity region 1415 1442 N/A INTRINSIC
low complexity region 1514 1531 N/A INTRINSIC
Meta Mutation Damage Score 0.1693 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily. Family members encode integral membrane proteins that mediate calcium-dependent cell-cell adhesion. It plays an essential role in maintenance of normal retinal and cochlear function. Mutations in this gene result in hearing loss and Usher Syndrome Type IF (USH1F). Extensive alternative splicing resulting in multiple isoforms has been observed in the mouse ortholog. Similar alternatively spliced transcripts are inferred to occur in human, and additional variants are likely to occur. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygotes for severe mutations exhibit circling, head-tossing, hyperactivity, impaired swimming and profound deafness. Mice have defects in cochlea and degeneration of hair cells, spiral ganglion cells and saccular macula. Females are poor mothers. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Gene trapped(2) Transgenic(1) Spontaneous(6) Chemically induced(2)

Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,506 probably benign Het
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arpc1b T A 5: 145,127,715 W361R probably damaging Het
Baiap2l1 T C 5: 144,275,891 Y438C probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cntln C T 4: 85,096,757 T1095I probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dnah12 A G 14: 26,798,899 R1892G probably damaging Het
Dock4 A G 12: 40,621,312 probably benign Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Fam227b T A 2: 126,100,921 S319C probably damaging Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Gal3st2c C T 1: 94,009,497 P388L probably benign Het
Ggn C T 7: 29,171,296 P47S probably damaging Het
Gli3 T G 13: 15,724,785 L919R probably damaging Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 C A 1: 44,059,224 V905F probably benign Het
Gmip C T 8: 69,815,609 probably benign Het
Gpr39 C T 1: 125,677,500 T55M probably damaging Het
Grk4 A G 5: 34,716,213 T208A probably damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hadhb T C 5: 30,169,485 probably benign Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpa A T 2: 130,679,418 probably benign Het
Klhl10 A G 11: 100,456,932 T605A probably benign Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lap3 T C 5: 45,495,290 probably benign Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map3k6 T C 4: 133,243,794 L273P probably damaging Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mrc1 T A 2: 14,238,542 probably benign Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtcl1 C T 17: 66,358,114 E1149K possibly damaging Het
Naca C T 10: 128,044,790 A1897V probably benign Het
Ncapg T C 5: 45,693,147 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pla2g4a T A 1: 149,840,647 M688L possibly damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Prmt1 A G 7: 44,978,801 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Prom2 T G 2: 127,531,113 S679R possibly damaging Het
Psen2 T C 1: 180,238,914 T153A probably damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Stam2 A T 2: 52,719,986 probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Tas2r123 T C 6: 132,847,332 V64A probably benign Het
Tnnc1 A G 14: 31,211,408 D149G probably damaging Het
Tpp2 T A 1: 43,978,504 V756E probably benign Het
Tpp2 A G 1: 43,999,693 D1133G probably damaging Het
Traf3ip3 T A 1: 193,178,231 probably null Het
Tsen15 A G 1: 152,371,797 V148A probably damaging Het
Ttn T A 2: 76,864,328 probably benign Het
Ube2u A G 4: 100,486,673 I90V probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Wdr41 T C 13: 95,018,111 probably benign Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp423 A G 8: 87,782,259 S486P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Other mutations in Pcdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Pcdh15 APN 10 74185345 nonsense probably null
IGL00432:Pcdh15 APN 10 74291082 splice site probably benign
IGL00533:Pcdh15 APN 10 74502720 missense probably damaging 1.00
IGL00596:Pcdh15 APN 10 74630744 missense probably benign 0.00
IGL00930:Pcdh15 APN 10 74630698 missense probably benign 0.08
IGL00970:Pcdh15 APN 10 74379340 missense probably damaging 1.00
IGL01087:Pcdh15 APN 10 74342632 missense possibly damaging 0.90
IGL01763:Pcdh15 APN 10 74210461 missense probably benign 0.09
IGL01787:Pcdh15 APN 10 74450283 missense probably benign 0.25
IGL02070:Pcdh15 APN 10 74630868 missense probably benign 0.00
IGL02234:Pcdh15 APN 10 74631862 missense probably benign 0.02
IGL02268:Pcdh15 APN 10 74342672 missense probably damaging 1.00
IGL02280:Pcdh15 APN 10 74222463 missense probably damaging 1.00
IGL02363:Pcdh15 APN 10 74317086 missense probably damaging 0.98
IGL02420:Pcdh15 APN 10 74303106 missense probably damaging 0.98
IGL02749:Pcdh15 APN 10 74631068 missense probably benign 0.00
IGL02939:Pcdh15 APN 10 74504816 splice site probably benign
IGL02970:Pcdh15 APN 10 74290962 splice site probably benign
IGL03010:Pcdh15 APN 10 74385945 missense probably damaging 1.00
IGL03061:Pcdh15 APN 10 74317011 missense probably damaging 0.97
IGL03095:Pcdh15 APN 10 74355874 missense probably damaging 1.00
IGL03149:Pcdh15 APN 10 74630695 missense probably damaging 1.00
IGL03187:Pcdh15 APN 10 74355874 missense probably damaging 1.00
IGL03279:Pcdh15 APN 10 74317072 missense probably damaging 1.00
IGL03392:Pcdh15 APN 10 74624272 missense probably damaging 1.00
loop UTSW 10 74185378 missense probably damaging 1.00
mcduck UTSW 10 74626844 critical splice donor site probably null
spaz UTSW 10 74210425 missense probably damaging 1.00
sphere UTSW 10 74624284 missense probably damaging 1.00
squirm UTSW 10 large deletion
Tortilla UTSW 10 74379417 splice site probably null
1mM(1):Pcdh15 UTSW 10 74626137 intron probably benign
R0038:Pcdh15 UTSW 10 74643440 missense possibly damaging 0.95
R0103:Pcdh15 UTSW 10 74210425 missense probably damaging 1.00
R0111:Pcdh15 UTSW 10 74626819 nonsense probably null
R0119:Pcdh15 UTSW 10 74170575 missense probably damaging 1.00
R0131:Pcdh15 UTSW 10 74170608 missense probably null 1.00
R0445:Pcdh15 UTSW 10 74342549 missense probably damaging 1.00
R0464:Pcdh15 UTSW 10 74626844 critical splice donor site probably null
R0503:Pcdh15 UTSW 10 74210385 missense probably damaging 1.00
R0507:Pcdh15 UTSW 10 74621297 missense probably damaging 1.00
R0510:Pcdh15 UTSW 10 74290976 missense probably damaging 1.00
R0742:Pcdh15 UTSW 10 74621297 missense probably damaging 1.00
R0790:Pcdh15 UTSW 10 74631053 missense probably benign 0.01
R0829:Pcdh15 UTSW 10 74502766 missense probably damaging 1.00
R0839:Pcdh15 UTSW 10 74626782 missense probably null 1.00
R0882:Pcdh15 UTSW 10 74342656 missense probably damaging 1.00
R0894:Pcdh15 UTSW 10 74624255 missense probably damaging 1.00
R0944:Pcdh15 UTSW 10 74210470 missense probably damaging 0.99
R1081:Pcdh15 UTSW 10 74450313 missense probably damaging 1.00
R1148:Pcdh15 UTSW 10 74170560 missense probably damaging 1.00
R1148:Pcdh15 UTSW 10 74170560 missense probably damaging 1.00
R1484:Pcdh15 UTSW 10 74291001 missense probably damaging 1.00
R1521:Pcdh15 UTSW 10 74594191 missense probably damaging 1.00
R1694:Pcdh15 UTSW 10 74594163 missense probably damaging 1.00
R1795:Pcdh15 UTSW 10 74624255 missense probably damaging 1.00
R2021:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2022:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2023:Pcdh15 UTSW 10 74631193 missense possibly damaging 0.93
R2076:Pcdh15 UTSW 10 74342647 missense probably damaging 1.00
R2199:Pcdh15 UTSW 10 74170509 missense probably damaging 1.00
R2510:Pcdh15 UTSW 10 74631499 missense probably benign 0.39
R2511:Pcdh15 UTSW 10 74645996 missense possibly damaging 0.94
R3418:Pcdh15 UTSW 10 74584222 missense probably benign 0.12
R3419:Pcdh15 UTSW 10 74584222 missense probably benign 0.12
R3433:Pcdh15 UTSW 10 74631499 missense probably benign 0.39
R3619:Pcdh15 UTSW 10 74643395 missense probably damaging 0.99
R3723:Pcdh15 UTSW 10 74645848 missense probably benign 0.05
R3724:Pcdh15 UTSW 10 74645848 missense probably benign 0.05
R3778:Pcdh15 UTSW 10 73947151 splice site probably null
R3851:Pcdh15 UTSW 10 74631686 missense probably damaging 0.97
R4175:Pcdh15 UTSW 10 74631997 intron probably benign
R4261:Pcdh15 UTSW 10 74645680 missense probably damaging 1.00
R4385:Pcdh15 UTSW 10 74550490 missense probably damaging 1.00
R4585:Pcdh15 UTSW 10 74624284 missense probably damaging 1.00
R4602:Pcdh15 UTSW 10 74594214 missense probably damaging 1.00
R4639:Pcdh15 UTSW 10 74643607 missense probably benign 0.00
R4703:Pcdh15 UTSW 10 74450163 missense probably damaging 1.00
R4819:Pcdh15 UTSW 10 74324389 missense probably damaging 1.00
R4906:Pcdh15 UTSW 10 74504793 nonsense probably null
R4961:Pcdh15 UTSW 10 74379417 splice site probably null
R5018:Pcdh15 UTSW 10 74643775 missense possibly damaging 0.68
R5125:Pcdh15 UTSW 10 74584080 missense probably damaging 0.98
R5225:Pcdh15 UTSW 10 74303154 missense probably damaging 1.00
R5259:Pcdh15 UTSW 10 74396372 missense possibly damaging 0.67
R5279:Pcdh15 UTSW 10 74594183 missense probably damaging 1.00
R5395:Pcdh15 UTSW 10 74185287 missense probably damaging 1.00
R5458:Pcdh15 UTSW 10 74504779 missense probably damaging 1.00
R5617:Pcdh15 UTSW 10 74635672 intron probably benign
R5665:Pcdh15 UTSW 10 74626788 missense probably damaging 1.00
R5770:Pcdh15 UTSW 10 74185345 nonsense probably null
R5805:Pcdh15 UTSW 10 74230259 missense probably damaging 1.00
R5914:Pcdh15 UTSW 10 74630936 missense probably benign 0.42
R5988:Pcdh15 UTSW 10 74379357 missense probably benign 0.05
R6133:Pcdh15 UTSW 10 74645973 unclassified probably null
R6189:Pcdh15 UTSW 10 74342651 missense probably null 1.00
R6414:Pcdh15 UTSW 10 74185426 missense probably damaging 1.00
R6536:Pcdh15 UTSW 10 74631389 missense probably damaging 1.00
R6612:Pcdh15 UTSW 10 74185378 missense probably damaging 1.00
R6711:Pcdh15 UTSW 10 74642387 missense possibly damaging 0.83
R6793:Pcdh15 UTSW 10 74631139 missense probably damaging 1.00
R6841:Pcdh15 UTSW 10 74450220 missense probably damaging 1.00
R6845:Pcdh15 UTSW 10 74630633 missense probably benign
R6915:Pcdh15 UTSW 10 74643809 missense probably benign 0.16
R6954:Pcdh15 UTSW 10 74645989 missense possibly damaging 0.92
R6970:Pcdh15 UTSW 10 74502687 missense probably damaging 0.98
R7018:Pcdh15 UTSW 10 74466354 missense probably damaging 1.00
R7064:Pcdh15 UTSW 10 74630614 missense possibly damaging 0.67
R7079:Pcdh15 UTSW 10 74317125 missense probably benign 0.21
R7172:Pcdh15 UTSW 10 74502765 missense probably damaging 1.00
R7220:Pcdh15 UTSW 10 74342609 missense possibly damaging 0.64
R7237:Pcdh15 UTSW 10 74584191 missense possibly damaging 0.88
R7266:Pcdh15 UTSW 10 74379390 nonsense probably null
R7276:Pcdh15 UTSW 10 74324392 missense probably benign 0.25
R7359:Pcdh15 UTSW 10 74584216 missense probably damaging 0.99
R7396:Pcdh15 UTSW 10 74630690 missense probably benign 0.17
R7421:Pcdh15 UTSW 10 74454065 missense possibly damaging 0.90
R7424:Pcdh15 UTSW 10 74506485 missense probably benign 0.09
R7463:Pcdh15 UTSW 10 74631770 missense possibly damaging 0.66
R7469:Pcdh15 UTSW 10 74645980 missense probably benign
R7512:Pcdh15 UTSW 10 74641382 missense possibly damaging 0.81
R7767:Pcdh15 UTSW 10 74486256 missense probably benign 0.07
R7830:Pcdh15 UTSW 10 74385901 missense probably damaging 1.00
R7890:Pcdh15 UTSW 10 74642314 missense probably damaging 1.00
R7897:Pcdh15 UTSW 10 74453995 missense probably damaging 1.00
R7908:Pcdh15 UTSW 10 74643582 missense probably benign 0.04
R7973:Pcdh15 UTSW 10 74642314 missense probably damaging 1.00
R7980:Pcdh15 UTSW 10 74453995 missense probably damaging 1.00
R7989:Pcdh15 UTSW 10 74643582 missense probably benign 0.04
RF020:Pcdh15 UTSW 10 74185410 missense probably damaging 1.00
Z1176:Pcdh15 UTSW 10 74630701 missense probably benign 0.00
Z1177:Pcdh15 UTSW 10 74504800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACACATAGCTACTACAGGCTTTCG -3'
(R):5'- GCTTAAACATTTTCAGAGGAGAAACGGG -3'

Sequencing Primer
(F):5'- ATAGCTACTACAGGCTTTCGTTTTG -3'
(R):5'- GAAACGGGCTATGTGTTTCTATATC -3'
Posted On2013-04-11