Mutagenetix > Incidental Mutation

Incidental Mutation 'R1861:Smarca2'

203977

Institutional Source

Beutler Lab

Gene Symbol

Smarca2

Ensembl Gene

ENSMUSG00000024921

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2

Synonyms

Snf2l2, brm, 2610209L14Rik

MMRRC Submission

039884-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1861 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

26605050-26778322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 26623884 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 77 (M77L)

Ref Sequence

ENSEMBL: ENSMUSP00000097135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000176030] [ENSMUST00000176584] [ENSMUST00000176769] [ENSMUST00000208163]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000025862
AA Change: M77L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921
AA Change: M77L

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	8e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
BROMO	1391	1501	3.13e-41	SMART
low complexity region	1502	1524	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1564	1576	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000099537
AA Change: M77L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921
AA Change: M77L

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	7e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
PDB:2DAT\|A	1389	1410	1e-6	PDB
low complexity region	1480	1508	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176030
AA Change: M77L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921
AA Change: M77L

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	923	1.34e-36	SMART
Blast:DEXDc	934	966	8e-10	BLAST
low complexity region	1005	1014	N/A	INTRINSIC
HELICc	1091	1175	3.84e-23	SMART
low complexity region	1233	1248	N/A	INTRINSIC
SnAC	1269	1337	7.29e-28	SMART
low complexity region	1344	1366	N/A	INTRINSIC
BROMO	1391	1519	1.74e-39	SMART
low complexity region	1520	1542	N/A	INTRINSIC
low complexity region	1544	1558	N/A	INTRINSIC
low complexity region	1582	1594	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176584
AA Change: M1L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000135344
Gene: ENSMUSG00000024921
AA Change: M1L

Domain	Start	End	E-Value	Type
low complexity region	22	37	N/A	INTRINSIC
low complexity region	59	78	N/A	INTRINSIC
QLQ	96	132	2.58e-13	SMART
low complexity region	140	172	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176769
AA Change: M77L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921
AA Change: M77L

Domain	Start	End	E-Value	Type
low complexity region	11	58	N/A	INTRINSIC
low complexity region	98	113	N/A	INTRINSIC
low complexity region	135	154	N/A	INTRINSIC
QLQ	172	208	2.58e-13	SMART
low complexity region	216	264	N/A	INTRINSIC
low complexity region	290	314	N/A	INTRINSIC
low complexity region	394	405	N/A	INTRINSIC
HSA	447	519	1.44e-28	SMART
low complexity region	559	579	N/A	INTRINSIC
BRK	601	645	1.9e-19	SMART
DEXDc	731	908	4.18e-24	SMART
low complexity region	947	956	N/A	INTRINSIC
HELICc	1033	1117	3.84e-23	SMART
low complexity region	1175	1190	N/A	INTRINSIC
SnAC	1211	1279	7.29e-28	SMART
low complexity region	1286	1308	N/A	INTRINSIC
BROMO	1333	1443	3.13e-41	SMART
low complexity region	1444	1466	N/A	INTRINSIC
low complexity region	1468	1482	N/A	INTRINSIC
low complexity region	1506	1518	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177262

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177453

Predicted Effect

probably benign
Transcript: ENSMUST00000208163
AA Change: M1L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.2%
20x: 92.0%

Validation Efficiency

97% (117/121)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 113 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	A	G	13: 63,015,783	Y206C	probably damaging	Het
2610507B11Rik	C	T	11: 78,287,929		probably benign	Het
4930579C12Rik	C	A	9: 89,152,831		noncoding transcript	Het
4933417A18Rik	A	T	13: 34,932,507	I80F	possibly damaging	Het
9530053A07Rik	A	G	7: 28,154,732	Y1707C	probably damaging	Het
Abra	C	A	15: 41,869,034	R212L	probably damaging	Het
Actr1a	T	C	19: 46,384,275	E87G	probably damaging	Het
Adam26a	A	G	8: 43,569,541	V304A	possibly damaging	Het
Alg2	T	A	4: 47,471,670	K379N	probably benign	Het
Alk	G	T	17: 71,874,938		probably benign	Het
Arhgef17	A	G	7: 100,882,268	Y331H	probably damaging	Het
Art3	A	G	5: 92,412,235		probably benign	Het
Asap1	G	A	15: 64,135,798		probably benign	Het
Atad2	A	T	15: 58,096,718		probably null	Het
Atp8b5	G	A	4: 43,372,906	R1150H	probably damaging	Het
B020004J07Rik	A	T	4: 101,836,938	D249E	probably benign	Het
Brdt	T	C	5: 107,359,458	S575P	probably benign	Het
Capn3	T	A	2: 120,486,482		probably benign	Het
Casd1	T	A	6: 4,640,951	Y691N	probably damaging	Het
Ccdc127	T	G	13: 74,356,979	H215Q	possibly damaging	Het
Cenpe	T	C	3: 135,268,979	L2300P	probably damaging	Het
Clasp1	T	C	1: 118,570,931	F898L	possibly damaging	Het
Clcn1	C	A	6: 42,313,991	P933Q	possibly damaging	Het
Cntn3	T	A	6: 102,245,071	N489I	probably benign	Het
Col16a1	T	C	4: 130,061,724		probably benign	Het
Col24a1	G	A	3: 145,537,267		probably null	Het
Col8a2	C	T	4: 126,311,624		probably benign	Het
Cpd	T	C	11: 76,784,382		probably benign	Het
Csmd3	A	T	15: 47,659,192	C2694S	probably damaging	Het
Cyp2c40	T	C	19: 39,786,875	Y311C	probably benign	Het
D230025D16Rik	A	G	8: 105,240,071	E150G	probably null	Het
Dennd5b	T	A	6: 149,068,262	N231I	probably damaging	Het
Dgkh	T	A	14: 78,578,792	H936L	probably benign	Het
Dmtf1	T	C	5: 9,120,347		probably null	Het
Dnaic2	T	C	11: 114,752,951	V481A	possibly damaging	Het
Dpyd	T	G	3: 118,917,131	V396G	probably damaging	Het
Elmo3	A	G	8: 105,308,581	D448G	probably damaging	Het
Emsy	A	T	7: 98,641,615	V100E	probably damaging	Het
Erbb2	T	C	11: 98,412,737		probably null	Het
Faah	T	C	4: 116,008,235	K85R	probably benign	Het
Fam149a	A	T	8: 45,339,362	Y686*	probably null	Het
Fat4	T	C	3: 39,010,484	V4863A	probably benign	Het
Fbxl8	A	G	8: 105,268,929	T358A	probably damaging	Het
Fgfr3	A	G	5: 33,729,746	T165A	probably damaging	Het
Fnbp1l	A	T	3: 122,560,932	H180Q	probably damaging	Het
Gm8180	T	A	14: 43,783,739	H4L	probably benign	Het
Gon4l	T	C	3: 88,895,487	V1135A	probably damaging	Het
Gstcd	G	T	3: 132,983,107	N627K	probably damaging	Het
Gtf2a1l	G	A	17: 88,714,954	V458I	probably damaging	Het
Gtf3c3	T	C	1: 54,438,838	E26G	possibly damaging	Het
Hrct1	A	T	4: 43,727,404	T15S	probably benign	Het
Ift122	C	A	6: 115,891,928	R459S	probably damaging	Het
Irf1	T	A	11: 53,774,357	C187S	possibly damaging	Het
Kcnh7	A	G	2: 62,777,392	V615A	probably damaging	Het
Kif1c	T	C	11: 70,703,342	S61P	probably damaging	Het
Mamdc2	T	C	19: 23,359,153	T331A	probably damaging	Het
Mark2	T	C	19: 7,290,763	D25G	possibly damaging	Het
Me2	T	C	18: 73,785,714	D432G	probably benign	Het
Mfap3	T	C	11: 57,528,206	V64A	probably benign	Het
Nadk2	T	A	15: 9,108,311	M416K	probably benign	Het
Ndufs1	C	T	1: 63,147,417	G631D	probably benign	Het
Nomo1	G	A	7: 46,078,101	V1055I	probably benign	Het
Nuggc	T	A	14: 65,642,001		probably benign	Het
Nwd2	T	C	5: 63,804,854	S594P	probably damaging	Het
Olfr1197	T	G	2: 88,729,330	I90L	probably damaging	Het
Olfr1272	C	A	2: 90,282,158	C139F	probably damaging	Het
Olfr1467	T	A	19: 13,365,341	S238T	possibly damaging	Het
Olfr250	C	T	9: 38,367,606	S10L	probably benign	Het
Olfr273	T	A	4: 52,856,373	I47L	probably benign	Het
Olfr414	T	C	1: 174,431,091	I221T	probably damaging	Het
Palm2	A	G	4: 57,709,468	I138V	probably damaging	Het
Pcyt2	G	A	11: 120,611,142	P332S	probably benign	Het
Phf14	A	T	6: 11,987,611	M630L	probably benign	Het
Piezo1	T	C	8: 122,495,750	N919S	possibly damaging	Het
Pif1	A	T	9: 65,589,453	I283F	probably damaging	Het
Pknox2	G	A	9: 36,923,661	H171Y	probably damaging	Het
Prkg2	T	A	5: 98,947,416	D632V	probably damaging	Het
Prr29	G	A	11: 106,375,438	A6T	probably damaging	Het
Rims1	T	A	1: 22,596,558	Y114F	probably damaging	Het
Ryr1	A	T	7: 29,009,552	D4796E	unknown	Het
Scnn1b	G	A	7: 121,914,261	C399Y	probably damaging	Het
Scp2	T	C	4: 108,091,321	Y153C	probably damaging	Het
Sema3d	A	G	5: 12,497,603	K164R	probably benign	Het
Siglecf	A	G	7: 43,352,224	T153A	probably benign	Het
Siglecf	A	G	7: 43,355,543	N399S	probably benign	Het
Skint2	T	C	4: 112,647,118		probably benign	Het
Slc22a8	G	A	19: 8,606,139	R236H	probably damaging	Het
Slc25a40	T	A	5: 8,442,431		probably null	Het
Slc26a5	T	C	5: 21,816,958	D490G	possibly damaging	Het
Slc26a7	G	T	4: 14,522,873	D482E	probably benign	Het
Sos2	A	G	12: 69,617,363	L449P	probably damaging	Het
Spaca1	A	G	4: 34,044,206	V96A	probably damaging	Het
Spata31d1b	T	A	13: 59,717,336	I766N	possibly damaging	Het
Specc1l	T	C	10: 75,309,859	Y1113H	probably damaging	Het
Speg	A	G	1: 75,389,005	R677G	probably damaging	Het
Taf5l	A	T	8: 123,997,990	D363E	probably damaging	Het
Tmem208	A	G	8: 105,334,806	K155E	possibly damaging	Het
Tppp2	A	C	14: 51,920,605	N169T	probably benign	Het
Trrap	T	A	5: 144,815,917		probably null	Het
Ttll6	T	A	11: 96,138,874	Y204*	probably null	Het
Ttn	A	T	2: 76,772,648	I18410K	probably benign	Het
V1rd19	T	A	7: 24,003,724	V205D	probably damaging	Het
Vdac3	A	T	8: 22,580,499	I132K	possibly damaging	Het
Vmn2r95	T	G	17: 18,452,268	C756G	probably damaging	Het
Wdr63	T	C	3: 146,083,046	Y260C	probably damaging	Het
Zc3h15	A	G	2: 83,663,990	T421A	unknown	Het
Zc3hc1	T	C	6: 30,374,838	T235A	probably benign	Het
Zcchc14	A	G	8: 121,609,251		probably benign	Het
Zfp318	T	A	17: 46,411,440	N1456K	possibly damaging	Het
Zfp606	A	G	7: 12,480,931		probably benign	Het
Zfp811	T	A	17: 32,797,425	H546L	probably damaging	Het
Zfp94	A	T	7: 24,309,116	Y33N	probably damaging	Het
Zfyve9	G	T	4: 108,682,295		probably benign	Het

Other mutations in Smarca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01368:Smarca2	APN	19	26774294	missense	possibly damaging	0.82
IGL01907:Smarca2	APN	19	26698465	missense	possibly damaging	0.59
IGL02039:Smarca2	APN	19	26716137	missense	probably damaging	1.00
IGL02110:Smarca2	APN	19	26672740	missense	possibly damaging	0.96
IGL02561:Smarca2	APN	19	26716182	missense	possibly damaging	0.92
IGL02649:Smarca2	APN	19	26640586	missense	possibly damaging	0.73
IGL02880:Smarca2	APN	19	26676624	splice site	probably benign
IGL03028:Smarca2	APN	19	26678312	splice site	probably benign
IGL03187:Smarca2	APN	19	26672824	missense	probably damaging	0.98
IGL03213:Smarca2	APN	19	26623975	missense	probably damaging	1.00
IGL03354:Smarca2	APN	19	26619903	missense	probably benign	0.01
Genghis	UTSW	19	26619884	missense	possibly damaging	0.53
kraft	UTSW	19	26678363	missense	probably damaging	0.99
Kublai	UTSW	19	26640613	missense	probably damaging	1.00
Samarkand	UTSW	19	26654464	nonsense	probably null
tashkent	UTSW	19	26720873	missense	probably benign	0.06
Xanadu	UTSW	19	26682052	missense	possibly damaging	0.52
FR4737:Smarca2	UTSW	19	26630999	unclassified	probably benign
PIT1430001:Smarca2	UTSW	19	26649093	missense	probably benign	0.35
R0184:Smarca2	UTSW	19	26692249	nonsense	probably null
R0306:Smarca2	UTSW	19	26640613	missense	probably damaging	1.00
R0538:Smarca2	UTSW	19	26691362	missense	probably damaging	0.99
R0565:Smarca2	UTSW	19	26681875	missense	possibly damaging	0.71
R0610:Smarca2	UTSW	19	26691391	missense	probably damaging	1.00
R0669:Smarca2	UTSW	19	26706200	missense	possibly damaging	0.51
R0726:Smarca2	UTSW	19	26698403	missense	probably damaging	1.00
R1184:Smarca2	UTSW	19	26770933	splice site	probably benign
R1256:Smarca2	UTSW	19	26681973	missense	probably benign	0.06
R1299:Smarca2	UTSW	19	26771611	critical splice donor site	probably null
R1306:Smarca2	UTSW	19	26770988	missense	possibly damaging	0.81
R1381:Smarca2	UTSW	19	26630828	missense	probably damaging	1.00
R1400:Smarca2	UTSW	19	26676740	missense	probably damaging	0.98
R1415:Smarca2	UTSW	19	26710684	missense	probably null	0.72
R1496:Smarca2	UTSW	19	26631101	missense	possibly damaging	0.85
R1582:Smarca2	UTSW	19	26751905	missense	probably damaging	0.99
R1666:Smarca2	UTSW	19	26647034	missense	possibly damaging	0.65
R1668:Smarca2	UTSW	19	26647034	missense	possibly damaging	0.65
R1751:Smarca2	UTSW	19	26640380	splice site	probably benign
R1962:Smarca2	UTSW	19	26672724	nonsense	probably null
R1964:Smarca2	UTSW	19	26672724	nonsense	probably null
R1998:Smarca2	UTSW	19	26631093	missense	probably benign	0.33
R2014:Smarca2	UTSW	19	26683905	missense	possibly damaging	0.86
R2255:Smarca2	UTSW	19	26771038	missense	probably benign	0.01
R2392:Smarca2	UTSW	19	26640650	critical splice donor site	probably null
R2439:Smarca2	UTSW	19	26691454	critical splice donor site	probably null
R3030:Smarca2	UTSW	19	26752029	missense	possibly damaging	0.84
R3195:Smarca2	UTSW	19	26683822	missense	possibly damaging	0.85
R3430:Smarca2	UTSW	19	26691349	missense	probably damaging	1.00
R3710:Smarca2	UTSW	19	26668890	unclassified	probably benign
R3845:Smarca2	UTSW	19	26720873	missense	probably benign	0.06
R4013:Smarca2	UTSW	19	26683927	splice site	probably null
R4014:Smarca2	UTSW	19	26683927	splice site	probably null
R4016:Smarca2	UTSW	19	26683927	splice site	probably null
R4271:Smarca2	UTSW	19	26720949	critical splice donor site	probably null
R4471:Smarca2	UTSW	19	26619877	missense	possibly damaging	0.86
R4612:Smarca2	UTSW	19	26776225	missense	possibly damaging	0.70
R4730:Smarca2	UTSW	19	26630673	missense	probably damaging	1.00
R4755:Smarca2	UTSW	19	26654483	missense	possibly damaging	0.86
R4999:Smarca2	UTSW	19	26720855	nonsense	probably null
R5015:Smarca2	UTSW	19	26691388	missense	possibly damaging	0.86
R5320:Smarca2	UTSW	19	26691372	missense	probably damaging	1.00
R5393:Smarca2	UTSW	19	26640429	missense	probably benign	0.18
R5503:Smarca2	UTSW	19	26623936	missense	probably damaging	0.96
R5503:Smarca2	UTSW	19	26682046	missense	possibly damaging	0.93
R5715:Smarca2	UTSW	19	26649122	missense	probably benign	0.16
R5790:Smarca2	UTSW	19	26676724	missense	probably damaging	1.00
R5874:Smarca2	UTSW	19	26776069	intron	probably benign
R6209:Smarca2	UTSW	19	26771004	nonsense	probably null
R6236:Smarca2	UTSW	19	26696213	missense	probably benign	0.33
R6291:Smarca2	UTSW	19	26630892	missense	probably damaging	1.00
R6292:Smarca2	UTSW	19	26630892	missense	probably damaging	1.00
R6325:Smarca2	UTSW	19	26678363	missense	probably damaging	0.99
R6544:Smarca2	UTSW	19	26630931	missense	probably damaging	1.00
R6572:Smarca2	UTSW	19	26679173	missense	possibly damaging	0.71
R6589:Smarca2	UTSW	19	26619884	missense	possibly damaging	0.53
R6601:Smarca2	UTSW	19	26654377	missense	probably benign	0.30
R6804:Smarca2	UTSW	19	26751886	missense	possibly damaging	0.93
R6922:Smarca2	UTSW	19	26691349	missense	probably damaging	1.00
R7047:Smarca2	UTSW	19	26669155	missense	possibly damaging	0.83
R7213:Smarca2	UTSW	19	26647131	missense	possibly damaging	0.96
R7257:Smarca2	UTSW	19	26654464	nonsense	probably null
R7259:Smarca2	UTSW	19	26654464	nonsense	probably null
R7479:Smarca2	UTSW	19	26640487	missense	probably benign	0.00
R7512:Smarca2	UTSW	19	26683809	missense	possibly damaging	0.51
R8158:Smarca2	UTSW	19	26682048	missense	probably benign	0.16
R8182:Smarca2	UTSW	19	26630720	missense	probably benign	0.39
R8207:Smarca2	UTSW	19	26676680	missense	possibly damaging	0.71
R8467:Smarca2	UTSW	19	26619721	start codon destroyed	probably null	0.02
R8527:Smarca2	UTSW	19	26676787	missense	probably damaging	0.98
R8784:Smarca2	UTSW	19	26776158	missense	probably benign	0.17
R8898:Smarca2	UTSW	19	26630958	unclassified	probably benign
R9076:Smarca2	UTSW	19	26682052	missense	possibly damaging	0.52
R9123:Smarca2	UTSW	19	26716183	missense	possibly damaging	0.84
R9125:Smarca2	UTSW	19	26716183	missense	possibly damaging	0.84
R9317:Smarca2	UTSW	19	26759879	missense	possibly damaging	0.75
R9501:Smarca2	UTSW	19	26640577	missense	probably benign	0.04
R9514:Smarca2	UTSW	19	26682052	missense	possibly damaging	0.71
R9641:Smarca2	UTSW	19	26679098	missense	possibly damaging	0.93
RF001:Smarca2	UTSW	19	26630986	unclassified	probably benign
RF001:Smarca2	UTSW	19	26631021	unclassified	probably benign
RF004:Smarca2	UTSW	19	26631020	unclassified	probably benign
RF019:Smarca2	UTSW	19	26631001	unclassified	probably benign
RF021:Smarca2	UTSW	19	26630997	unclassified	probably benign
RF024:Smarca2	UTSW	19	26631020	unclassified	probably benign
RF034:Smarca2	UTSW	19	26631011	unclassified	probably benign
RF040:Smarca2	UTSW	19	26631022	unclassified	probably benign
RF041:Smarca2	UTSW	19	26631021	unclassified	probably benign
RF047:Smarca2	UTSW	19	26631005	unclassified	probably benign
RF051:Smarca2	UTSW	19	26630988	unclassified	probably benign
X0061:Smarca2	UTSW	19	26720840	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGTTGTGACATTGGCTAAAGAATG -3'
(R):5'- CAGGAAAGACTGATACCTCTTTAAC -3'

Sequencing Primer
(F):5'- TGAAATTCAACCATTTCTAACGCC -3'
(R):5'- GACTGATACCTCTTTAACATGGTATG -3'

Posted On

2014-06-23