Incidental Mutation 'R1861:Smarca2'
ID 203977
Institutional Source Beutler Lab
Gene Symbol Smarca2
Ensembl Gene ENSMUSG00000024921
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2
Synonyms Snf2l2, brm, 2610209L14Rik
MMRRC Submission 039884-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1861 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 26582578-26755721 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 26601284 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 77 (M77L)
Ref Sequence ENSEMBL: ENSMUSP00000097135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025862] [ENSMUST00000099537] [ENSMUST00000176030] [ENSMUST00000176584] [ENSMUST00000176769] [ENSMUST00000208163]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000025862
AA Change: M77L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025862
Gene: ENSMUSG00000024921
AA Change: M77L

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1501 3.13e-41 SMART
low complexity region 1502 1524 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1564 1576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099537
AA Change: M77L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000097135
Gene: ENSMUSG00000024921
AA Change: M77L

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 7e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
PDB:2DAT|A 1389 1410 1e-6 PDB
low complexity region 1480 1508 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176030
AA Change: M77L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135784
Gene: ENSMUSG00000024921
AA Change: M77L

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 923 1.34e-36 SMART
Blast:DEXDc 934 966 8e-10 BLAST
low complexity region 1005 1014 N/A INTRINSIC
HELICc 1091 1175 3.84e-23 SMART
low complexity region 1233 1248 N/A INTRINSIC
SnAC 1269 1337 7.29e-28 SMART
low complexity region 1344 1366 N/A INTRINSIC
BROMO 1391 1519 1.74e-39 SMART
low complexity region 1520 1542 N/A INTRINSIC
low complexity region 1544 1558 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176584
AA Change: M1L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135344
Gene: ENSMUSG00000024921
AA Change: M1L

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
QLQ 96 132 2.58e-13 SMART
low complexity region 140 172 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176769
AA Change: M77L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135017
Gene: ENSMUSG00000024921
AA Change: M77L

DomainStartEndE-ValueType
low complexity region 11 58 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
low complexity region 135 154 N/A INTRINSIC
QLQ 172 208 2.58e-13 SMART
low complexity region 216 264 N/A INTRINSIC
low complexity region 290 314 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
HSA 447 519 1.44e-28 SMART
low complexity region 559 579 N/A INTRINSIC
BRK 601 645 1.9e-19 SMART
DEXDc 731 908 4.18e-24 SMART
low complexity region 947 956 N/A INTRINSIC
HELICc 1033 1117 3.84e-23 SMART
low complexity region 1175 1190 N/A INTRINSIC
SnAC 1211 1279 7.29e-28 SMART
low complexity region 1286 1308 N/A INTRINSIC
BROMO 1333 1443 3.13e-41 SMART
low complexity region 1444 1466 N/A INTRINSIC
low complexity region 1468 1482 N/A INTRINSIC
low complexity region 1506 1518 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177262
Predicted Effect probably benign
Transcript: ENSMUST00000208163
AA Change: M1L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177453
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (117/121)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is highly similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, which contains a trinucleotide repeat (CAG) length polymorphism. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene may exhibit infertility and a slightly increased body weight in some genetic backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik C A 9: 89,034,884 (GRCm39) noncoding transcript Het
Abra C A 15: 41,732,430 (GRCm39) R212L probably damaging Het
Actr1a T C 19: 46,372,714 (GRCm39) E87G probably damaging Het
Adam26a A G 8: 44,022,578 (GRCm39) V304A possibly damaging Het
Alg2 T A 4: 47,471,670 (GRCm39) K379N probably benign Het
Alk G T 17: 72,181,933 (GRCm39) probably benign Het
Aopep A G 13: 63,163,597 (GRCm39) Y206C probably damaging Het
Arhgef17 A G 7: 100,531,475 (GRCm39) Y331H probably damaging Het
Art3 A G 5: 92,560,094 (GRCm39) probably benign Het
Asap1 G A 15: 64,007,647 (GRCm39) probably benign Het
Atad2 A T 15: 57,960,114 (GRCm39) probably null Het
Atp8b5 G A 4: 43,372,906 (GRCm39) R1150H probably damaging Het
Bltp2 C T 11: 78,178,755 (GRCm39) probably benign Het
Brdt T C 5: 107,507,324 (GRCm39) S575P probably benign Het
Capn3 T A 2: 120,316,963 (GRCm39) probably benign Het
Casd1 T A 6: 4,640,951 (GRCm39) Y691N probably damaging Het
Ccdc127 T G 13: 74,505,098 (GRCm39) H215Q possibly damaging Het
Cenpe T C 3: 134,974,740 (GRCm39) L2300P probably damaging Het
Clasp1 T C 1: 118,498,661 (GRCm39) F898L possibly damaging Het
Clcn1 C A 6: 42,290,925 (GRCm39) P933Q possibly damaging Het
Cntn3 T A 6: 102,222,032 (GRCm39) N489I probably benign Het
Col16a1 T C 4: 129,955,517 (GRCm39) probably benign Het
Col24a1 G A 3: 145,243,022 (GRCm39) probably null Het
Col8a2 C T 4: 126,205,417 (GRCm39) probably benign Het
Cpd T C 11: 76,675,208 (GRCm39) probably benign Het
Csmd3 A T 15: 47,522,588 (GRCm39) C2694S probably damaging Het
Cyp2c40 T C 19: 39,775,319 (GRCm39) Y311C probably benign Het
Dennd5b T A 6: 148,969,760 (GRCm39) N231I probably damaging Het
Dgkh T A 14: 78,816,232 (GRCm39) H936L probably benign Het
Dmtf1 T C 5: 9,170,347 (GRCm39) probably null Het
Dnai2 T C 11: 114,643,777 (GRCm39) V481A possibly damaging Het
Dnai3 T C 3: 145,788,801 (GRCm39) Y260C probably damaging Het
Dpyd T G 3: 118,710,780 (GRCm39) V396G probably damaging Het
Elmo3 A G 8: 106,035,213 (GRCm39) D448G probably damaging Het
Emsy A T 7: 98,290,822 (GRCm39) V100E probably damaging Het
Erbb2 T C 11: 98,303,563 (GRCm39) probably null Het
Faah T C 4: 115,865,432 (GRCm39) K85R probably benign Het
Fam149a A T 8: 45,792,399 (GRCm39) Y686* probably null Het
Fat4 T C 3: 39,064,633 (GRCm39) V4863A probably benign Het
Fbxl8 A G 8: 105,995,561 (GRCm39) T358A probably damaging Het
Fcgbpl1 A G 7: 27,854,157 (GRCm39) Y1707C probably damaging Het
Fgfr3 A G 5: 33,887,090 (GRCm39) T165A probably damaging Het
Fnbp1l A T 3: 122,354,581 (GRCm39) H180Q probably damaging Het
Gm8180 T A 14: 44,021,196 (GRCm39) H4L probably benign Het
Gon4l T C 3: 88,802,794 (GRCm39) V1135A probably damaging Het
Gstcd G T 3: 132,688,868 (GRCm39) N627K probably damaging Het
Gtf2a1l G A 17: 89,022,382 (GRCm39) V458I probably damaging Het
Gtf3c3 T C 1: 54,477,997 (GRCm39) E26G possibly damaging Het
Hrct1 A T 4: 43,727,404 (GRCm39) T15S probably benign Het
Ift122 C A 6: 115,868,889 (GRCm39) R459S probably damaging Het
Irf1 T A 11: 53,665,183 (GRCm39) C187S possibly damaging Het
Kcnh7 A G 2: 62,607,736 (GRCm39) V615A probably damaging Het
Kif1c T C 11: 70,594,168 (GRCm39) S61P probably damaging Het
Mamdc2 T C 19: 23,336,517 (GRCm39) T331A probably damaging Het
Mark2 T C 19: 7,268,128 (GRCm39) D25G possibly damaging Het
Me2 T C 18: 73,918,785 (GRCm39) D432G probably benign Het
Mfap3 T C 11: 57,419,032 (GRCm39) V64A probably benign Het
Nadk2 T A 15: 9,108,399 (GRCm39) M416K probably benign Het
Ndufs1 C T 1: 63,186,576 (GRCm39) G631D probably benign Het
Nomo1 G A 7: 45,727,525 (GRCm39) V1055I probably benign Het
Nuggc T A 14: 65,879,450 (GRCm39) probably benign Het
Nwd2 T C 5: 63,962,197 (GRCm39) S594P probably damaging Het
Or13c3 T A 4: 52,856,373 (GRCm39) I47L probably benign Het
Or4a27 T G 2: 88,559,674 (GRCm39) I90L probably damaging Het
Or4b1b C A 2: 90,112,502 (GRCm39) C139F probably damaging Het
Or5b113 T A 19: 13,342,705 (GRCm39) S238T possibly damaging Het
Or6p1 T C 1: 174,258,657 (GRCm39) I221T probably damaging Het
Or8c10 C T 9: 38,278,902 (GRCm39) S10L probably benign Het
Pakap A G 4: 57,709,468 (GRCm39) I138V probably damaging Het
Pcyt2 G A 11: 120,501,968 (GRCm39) P332S probably benign Het
Phaf1 A G 8: 105,966,703 (GRCm39) E150G probably null Het
Phf14 A T 6: 11,987,610 (GRCm39) M630L probably benign Het
Piezo1 T C 8: 123,222,489 (GRCm39) N919S possibly damaging Het
Pif1 A T 9: 65,496,735 (GRCm39) I283F probably damaging Het
Pknox2 G A 9: 36,834,957 (GRCm39) H171Y probably damaging Het
Pramel17 A T 4: 101,694,135 (GRCm39) D249E probably benign Het
Prkg2 T A 5: 99,095,275 (GRCm39) D632V probably damaging Het
Prr29 G A 11: 106,266,264 (GRCm39) A6T probably damaging Het
Rims1 T A 1: 22,635,639 (GRCm39) Y114F probably damaging Het
Ryr1 A T 7: 28,708,977 (GRCm39) D4796E unknown Het
Scnn1b G A 7: 121,513,484 (GRCm39) C399Y probably damaging Het
Scp2 T C 4: 107,948,518 (GRCm39) Y153C probably damaging Het
Sema3d A G 5: 12,547,570 (GRCm39) K164R probably benign Het
Siglecf A G 7: 43,004,967 (GRCm39) N399S probably benign Het
Siglecf A G 7: 43,001,648 (GRCm39) T153A probably benign Het
Skint2 T C 4: 112,504,315 (GRCm39) probably benign Het
Slc22a8 G A 19: 8,583,503 (GRCm39) R236H probably damaging Het
Slc25a40 T A 5: 8,492,431 (GRCm39) probably null Het
Slc26a5 T C 5: 22,021,956 (GRCm39) D490G possibly damaging Het
Slc26a7 G T 4: 14,522,873 (GRCm39) D482E probably benign Het
Sos2 A G 12: 69,664,137 (GRCm39) L449P probably damaging Het
Spaca1 A G 4: 34,044,206 (GRCm39) V96A probably damaging Het
Spata31d1b T A 13: 59,865,150 (GRCm39) I766N possibly damaging Het
Specc1l T C 10: 75,145,693 (GRCm39) Y1113H probably damaging Het
Speg A G 1: 75,365,649 (GRCm39) R677G probably damaging Het
Taf5l A T 8: 124,724,729 (GRCm39) D363E probably damaging Het
Tex56 A T 13: 35,116,490 (GRCm39) I80F possibly damaging Het
Tmem208 A G 8: 106,061,438 (GRCm39) K155E possibly damaging Het
Tppp2 A C 14: 52,158,062 (GRCm39) N169T probably benign Het
Trrap T A 5: 144,752,727 (GRCm39) probably null Het
Ttll6 T A 11: 96,029,700 (GRCm39) Y204* probably null Het
Ttn A T 2: 76,602,992 (GRCm39) I18410K probably benign Het
V1rd19 T A 7: 23,703,149 (GRCm39) V205D probably damaging Het
Vdac3 A T 8: 23,070,515 (GRCm39) I132K possibly damaging Het
Vmn2r95 T G 17: 18,672,530 (GRCm39) C756G probably damaging Het
Zc3h15 A G 2: 83,494,334 (GRCm39) T421A unknown Het
Zc3hc1 T C 6: 30,374,837 (GRCm39) T235A probably benign Het
Zcchc14 A G 8: 122,335,990 (GRCm39) probably benign Het
Zfp318 T A 17: 46,722,366 (GRCm39) N1456K possibly damaging Het
Zfp606 A G 7: 12,214,858 (GRCm39) probably benign Het
Zfp811 T A 17: 33,016,399 (GRCm39) H546L probably damaging Het
Zfp94 A T 7: 24,008,541 (GRCm39) Y33N probably damaging Het
Zfyve9 G T 4: 108,539,492 (GRCm39) probably benign Het
Other mutations in Smarca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Smarca2 APN 19 26,751,694 (GRCm39) missense possibly damaging 0.82
IGL01907:Smarca2 APN 19 26,675,865 (GRCm39) missense possibly damaging 0.59
IGL02039:Smarca2 APN 19 26,693,537 (GRCm39) missense probably damaging 1.00
IGL02110:Smarca2 APN 19 26,650,140 (GRCm39) missense possibly damaging 0.96
IGL02561:Smarca2 APN 19 26,693,582 (GRCm39) missense possibly damaging 0.92
IGL02649:Smarca2 APN 19 26,617,986 (GRCm39) missense possibly damaging 0.73
IGL02880:Smarca2 APN 19 26,654,024 (GRCm39) splice site probably benign
IGL03028:Smarca2 APN 19 26,655,712 (GRCm39) splice site probably benign
IGL03187:Smarca2 APN 19 26,650,224 (GRCm39) missense probably damaging 0.98
IGL03213:Smarca2 APN 19 26,601,375 (GRCm39) missense probably damaging 1.00
IGL03354:Smarca2 APN 19 26,597,303 (GRCm39) missense probably benign 0.01
Genghis UTSW 19 26,597,284 (GRCm39) missense possibly damaging 0.53
kraft UTSW 19 26,655,763 (GRCm39) missense probably damaging 0.99
Kublai UTSW 19 26,618,013 (GRCm39) missense probably damaging 1.00
Samarkand UTSW 19 26,631,864 (GRCm39) nonsense probably null
tashkent UTSW 19 26,698,273 (GRCm39) missense probably benign 0.06
Xanadu UTSW 19 26,659,452 (GRCm39) missense possibly damaging 0.52
FR4737:Smarca2 UTSW 19 26,608,399 (GRCm39) unclassified probably benign
PIT1430001:Smarca2 UTSW 19 26,626,493 (GRCm39) missense probably benign 0.35
R0184:Smarca2 UTSW 19 26,669,649 (GRCm39) nonsense probably null
R0306:Smarca2 UTSW 19 26,618,013 (GRCm39) missense probably damaging 1.00
R0538:Smarca2 UTSW 19 26,668,762 (GRCm39) missense probably damaging 0.99
R0565:Smarca2 UTSW 19 26,659,275 (GRCm39) missense possibly damaging 0.71
R0610:Smarca2 UTSW 19 26,668,791 (GRCm39) missense probably damaging 1.00
R0669:Smarca2 UTSW 19 26,683,600 (GRCm39) missense possibly damaging 0.51
R0726:Smarca2 UTSW 19 26,675,803 (GRCm39) missense probably damaging 1.00
R1184:Smarca2 UTSW 19 26,748,333 (GRCm39) splice site probably benign
R1256:Smarca2 UTSW 19 26,659,373 (GRCm39) missense probably benign 0.06
R1299:Smarca2 UTSW 19 26,749,011 (GRCm39) critical splice donor site probably null
R1306:Smarca2 UTSW 19 26,748,388 (GRCm39) missense possibly damaging 0.81
R1381:Smarca2 UTSW 19 26,608,228 (GRCm39) missense probably damaging 1.00
R1400:Smarca2 UTSW 19 26,654,140 (GRCm39) missense probably damaging 0.98
R1415:Smarca2 UTSW 19 26,688,084 (GRCm39) missense probably null 0.72
R1496:Smarca2 UTSW 19 26,608,501 (GRCm39) missense possibly damaging 0.85
R1582:Smarca2 UTSW 19 26,729,305 (GRCm39) missense probably damaging 0.99
R1666:Smarca2 UTSW 19 26,624,434 (GRCm39) missense possibly damaging 0.65
R1668:Smarca2 UTSW 19 26,624,434 (GRCm39) missense possibly damaging 0.65
R1751:Smarca2 UTSW 19 26,617,780 (GRCm39) splice site probably benign
R1962:Smarca2 UTSW 19 26,650,124 (GRCm39) nonsense probably null
R1964:Smarca2 UTSW 19 26,650,124 (GRCm39) nonsense probably null
R1998:Smarca2 UTSW 19 26,608,493 (GRCm39) missense probably benign 0.33
R2014:Smarca2 UTSW 19 26,661,305 (GRCm39) missense possibly damaging 0.86
R2255:Smarca2 UTSW 19 26,748,438 (GRCm39) missense probably benign 0.01
R2392:Smarca2 UTSW 19 26,618,050 (GRCm39) critical splice donor site probably null
R2439:Smarca2 UTSW 19 26,668,854 (GRCm39) critical splice donor site probably null
R3030:Smarca2 UTSW 19 26,729,429 (GRCm39) missense possibly damaging 0.84
R3195:Smarca2 UTSW 19 26,661,222 (GRCm39) missense possibly damaging 0.85
R3430:Smarca2 UTSW 19 26,668,749 (GRCm39) missense probably damaging 1.00
R3710:Smarca2 UTSW 19 26,646,290 (GRCm39) unclassified probably benign
R3845:Smarca2 UTSW 19 26,698,273 (GRCm39) missense probably benign 0.06
R4013:Smarca2 UTSW 19 26,661,327 (GRCm39) splice site probably null
R4014:Smarca2 UTSW 19 26,661,327 (GRCm39) splice site probably null
R4016:Smarca2 UTSW 19 26,661,327 (GRCm39) splice site probably null
R4271:Smarca2 UTSW 19 26,698,349 (GRCm39) critical splice donor site probably null
R4471:Smarca2 UTSW 19 26,597,277 (GRCm39) missense possibly damaging 0.86
R4612:Smarca2 UTSW 19 26,753,625 (GRCm39) missense possibly damaging 0.70
R4730:Smarca2 UTSW 19 26,608,073 (GRCm39) missense probably damaging 1.00
R4755:Smarca2 UTSW 19 26,631,883 (GRCm39) missense possibly damaging 0.86
R4999:Smarca2 UTSW 19 26,698,255 (GRCm39) nonsense probably null
R5015:Smarca2 UTSW 19 26,668,788 (GRCm39) missense possibly damaging 0.86
R5320:Smarca2 UTSW 19 26,668,772 (GRCm39) missense probably damaging 1.00
R5393:Smarca2 UTSW 19 26,617,829 (GRCm39) missense probably benign 0.18
R5503:Smarca2 UTSW 19 26,659,446 (GRCm39) missense possibly damaging 0.93
R5503:Smarca2 UTSW 19 26,601,336 (GRCm39) missense probably damaging 0.96
R5715:Smarca2 UTSW 19 26,626,522 (GRCm39) missense probably benign 0.16
R5790:Smarca2 UTSW 19 26,654,124 (GRCm39) missense probably damaging 1.00
R5874:Smarca2 UTSW 19 26,753,469 (GRCm39) intron probably benign
R6209:Smarca2 UTSW 19 26,748,404 (GRCm39) nonsense probably null
R6236:Smarca2 UTSW 19 26,673,613 (GRCm39) missense probably benign 0.33
R6291:Smarca2 UTSW 19 26,608,292 (GRCm39) missense probably damaging 1.00
R6292:Smarca2 UTSW 19 26,608,292 (GRCm39) missense probably damaging 1.00
R6325:Smarca2 UTSW 19 26,655,763 (GRCm39) missense probably damaging 0.99
R6544:Smarca2 UTSW 19 26,608,331 (GRCm39) missense probably damaging 1.00
R6572:Smarca2 UTSW 19 26,656,573 (GRCm39) missense possibly damaging 0.71
R6589:Smarca2 UTSW 19 26,597,284 (GRCm39) missense possibly damaging 0.53
R6601:Smarca2 UTSW 19 26,631,777 (GRCm39) missense probably benign 0.30
R6804:Smarca2 UTSW 19 26,729,286 (GRCm39) missense possibly damaging 0.93
R6922:Smarca2 UTSW 19 26,668,749 (GRCm39) missense probably damaging 1.00
R7047:Smarca2 UTSW 19 26,646,555 (GRCm39) missense possibly damaging 0.83
R7213:Smarca2 UTSW 19 26,624,531 (GRCm39) missense possibly damaging 0.96
R7257:Smarca2 UTSW 19 26,631,864 (GRCm39) nonsense probably null
R7259:Smarca2 UTSW 19 26,631,864 (GRCm39) nonsense probably null
R7479:Smarca2 UTSW 19 26,617,887 (GRCm39) missense probably benign 0.00
R7512:Smarca2 UTSW 19 26,661,209 (GRCm39) missense possibly damaging 0.51
R8158:Smarca2 UTSW 19 26,659,448 (GRCm39) missense probably benign 0.16
R8182:Smarca2 UTSW 19 26,608,120 (GRCm39) missense probably benign 0.39
R8207:Smarca2 UTSW 19 26,654,080 (GRCm39) missense possibly damaging 0.71
R8467:Smarca2 UTSW 19 26,597,121 (GRCm39) start codon destroyed probably null 0.02
R8527:Smarca2 UTSW 19 26,654,187 (GRCm39) missense probably damaging 0.98
R8784:Smarca2 UTSW 19 26,753,558 (GRCm39) missense probably benign 0.17
R8898:Smarca2 UTSW 19 26,608,358 (GRCm39) unclassified probably benign
R9076:Smarca2 UTSW 19 26,659,452 (GRCm39) missense possibly damaging 0.52
R9123:Smarca2 UTSW 19 26,693,583 (GRCm39) missense possibly damaging 0.84
R9125:Smarca2 UTSW 19 26,693,583 (GRCm39) missense possibly damaging 0.84
R9317:Smarca2 UTSW 19 26,737,279 (GRCm39) missense possibly damaging 0.75
R9501:Smarca2 UTSW 19 26,617,977 (GRCm39) missense probably benign 0.04
R9514:Smarca2 UTSW 19 26,659,452 (GRCm39) missense possibly damaging 0.71
R9641:Smarca2 UTSW 19 26,656,498 (GRCm39) missense possibly damaging 0.93
RF001:Smarca2 UTSW 19 26,608,421 (GRCm39) unclassified probably benign
RF001:Smarca2 UTSW 19 26,608,386 (GRCm39) unclassified probably benign
RF004:Smarca2 UTSW 19 26,608,420 (GRCm39) unclassified probably benign
RF019:Smarca2 UTSW 19 26,608,401 (GRCm39) unclassified probably benign
RF021:Smarca2 UTSW 19 26,608,397 (GRCm39) unclassified probably benign
RF024:Smarca2 UTSW 19 26,608,420 (GRCm39) unclassified probably benign
RF034:Smarca2 UTSW 19 26,608,411 (GRCm39) unclassified probably benign
RF040:Smarca2 UTSW 19 26,608,422 (GRCm39) unclassified probably benign
RF041:Smarca2 UTSW 19 26,608,421 (GRCm39) unclassified probably benign
RF047:Smarca2 UTSW 19 26,608,405 (GRCm39) unclassified probably benign
RF051:Smarca2 UTSW 19 26,608,388 (GRCm39) unclassified probably benign
X0061:Smarca2 UTSW 19 26,698,240 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGTTGTGACATTGGCTAAAGAATG -3'
(R):5'- CAGGAAAGACTGATACCTCTTTAAC -3'

Sequencing Primer
(F):5'- TGAAATTCAACCATTTCTAACGCC -3'
(R):5'- GACTGATACCTCTTTAACATGGTATG -3'
Posted On 2014-06-23