Incidental Mutation 'R1862:Crygd'
ID 203982
Institutional Source Beutler Lab
Gene Symbol Crygd
Ensembl Gene ENSMUSG00000067299
Gene Name crystallin, gamma D
Synonyms Aey4, DGcry-1, Cryg-1
MMRRC Submission 039885-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.269) question?
Stock # R1862 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 65101031-65102611 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 65101133 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 154 (Y154C)
Ref Sequence ENSEMBL: ENSMUSP00000045327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045028] [ENSMUST00000146122]
AlphaFold P04342
Predicted Effect probably benign
Transcript: ENSMUST00000045028
AA Change: Y154C

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000045327
Gene: ENSMUSG00000067299
AA Change: Y154C

DomainStartEndE-ValueType
XTALbg 3 82 3.23e-45 SMART
XTALbg 89 170 4.09e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127762
Predicted Effect probably benign
Transcript: ENSMUST00000146122
SMART Domains Protein: ENSMUSP00000122528
Gene: ENSMUSG00000067299

DomainStartEndE-ValueType
XTALbg 1 79 1.77e-42 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygotes for a spontaneous mutation exhibit a dense nuclear cataract and mild microphthalmia by 2-months of age, followed by posterior capsular rupture into the posterior vitreous by 3-months. In homozygotes, the microphthalmia is more pronounced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 (GRCm38) E565D probably benign Het
Adam30 A T 3: 98,069,429 (GRCm39) K421* probably null Het
Atp6v1b1 A G 6: 83,726,834 (GRCm39) probably null Het
Cacna1a A T 8: 85,142,559 (GRCm39) I96F possibly damaging Het
Card10 G A 15: 78,664,714 (GRCm39) R747W probably damaging Het
Cdh8 T A 8: 99,917,026 (GRCm39) D363V probably damaging Het
Cecr2 T C 6: 120,734,902 (GRCm39) Y685H probably damaging Het
Cibar1 C T 4: 12,155,717 (GRCm39) V306I possibly damaging Het
Cmklr1 T C 5: 113,752,468 (GRCm39) T178A probably damaging Het
Col16a1 G A 4: 129,986,575 (GRCm39) probably null Het
Col4a1 C T 8: 11,276,439 (GRCm39) probably benign Het
Coro2a T A 4: 46,548,797 (GRCm39) I166F possibly damaging Het
Cry2 T C 2: 92,254,911 (GRCm39) H148R probably damaging Het
Cubn T C 2: 13,313,372 (GRCm39) Y3066C probably damaging Het
Defb15 C T 8: 22,420,002 (GRCm39) E42K possibly damaging Het
Dnah12 A G 14: 26,418,553 (GRCm39) D147G probably benign Het
Dnah12 A T 14: 26,430,412 (GRCm39) Y340F probably benign Het
Dot1l G T 10: 80,619,373 (GRCm39) R193L probably damaging Het
Dusp29 A G 14: 21,736,757 (GRCm39) V115A probably benign Het
Esd A C 14: 74,979,514 (GRCm39) Y119S probably damaging Het
Esp36 A G 17: 38,730,330 (GRCm39) probably benign Het
Etfbkmt T A 6: 149,045,649 (GRCm39) M1K probably null Het
Exph5 A G 9: 53,287,548 (GRCm39) H1543R probably benign Het
Fbxo16 A G 14: 65,508,252 (GRCm39) T23A probably damaging Het
Gorasp2 C A 2: 70,509,808 (GRCm39) H136Q probably damaging Het
Hdc T A 2: 126,439,853 (GRCm39) I367F probably benign Het
Hmcn1 C T 1: 150,514,651 (GRCm39) V3574M probably benign Het
Ilvbl A G 10: 78,419,958 (GRCm39) D592G probably benign Het
Inmt G A 6: 55,151,868 (GRCm39) A34V probably damaging Het
Ints9 A C 14: 65,263,862 (GRCm39) H378P probably benign Het
Kcnh7 T A 2: 62,618,098 (GRCm39) I464L possibly damaging Het
Kcnt2 T A 1: 140,353,068 (GRCm39) V259D probably damaging Het
Lipo3 A G 19: 33,762,092 (GRCm39) F135S probably damaging Het
Lrba T C 3: 86,680,510 (GRCm39) probably null Het
Mapk1 T A 16: 16,844,293 (GRCm39) S22T probably benign Het
Mbd3l2 T C 9: 18,356,217 (GRCm39) S181P possibly damaging Het
Mgat5 C T 1: 127,387,706 (GRCm39) P554L probably damaging Het
Mki67 T C 7: 135,301,090 (GRCm39) T1315A probably benign Het
Mprip C T 11: 59,649,047 (GRCm39) T917M possibly damaging Het
Mroh3 T A 1: 136,113,726 (GRCm39) I688F probably benign Het
Myo1d A T 11: 80,553,874 (GRCm39) Y536N probably damaging Het
Neb C T 2: 52,052,199 (GRCm39) probably null Het
Noc2l A G 4: 156,322,165 (GRCm39) R161G probably benign Het
Nup54 T A 5: 92,567,426 (GRCm39) I375L possibly damaging Het
Nup93 T C 8: 95,032,730 (GRCm39) F539L probably damaging Het
Or10x1 T A 1: 174,197,018 (GRCm39) H178Q probably damaging Het
Or2n1e A G 17: 38,586,235 (GRCm39) E191G probably damaging Het
Or5p57 A C 7: 107,665,932 (GRCm39) Y24* probably null Het
Or8b12 T A 9: 37,658,264 (GRCm39) M278K probably benign Het
Panx1 A T 9: 14,918,724 (GRCm39) D378E probably damaging Het
Papss1 T A 3: 131,288,945 (GRCm39) V170D possibly damaging Het
Pcnx1 T C 12: 81,965,506 (GRCm39) S558P probably damaging Het
Pde3a G T 6: 141,433,239 (GRCm39) A757S probably damaging Het
Pde3a T A 6: 141,196,079 (GRCm39) I255N probably damaging Het
Pdzph1 A G 17: 59,229,578 (GRCm39) Y1027H probably damaging Het
Pkhd1 G T 1: 20,621,244 (GRCm39) R805S probably benign Het
Polr1a G A 6: 71,886,187 (GRCm39) G14D probably damaging Het
Prg4 T A 1: 150,336,420 (GRCm39) D60V probably damaging Het
Ptgr3 T C 18: 84,113,443 (GRCm39) V373A possibly damaging Het
Ptprc T C 1: 138,039,965 (GRCm39) S311G probably benign Het
Rapgefl1 G A 11: 98,733,035 (GRCm39) R205K probably benign Het
Rcan2 A T 17: 44,347,980 (GRCm39) probably null Het
Rock1 A G 18: 10,079,207 (GRCm39) I1087T probably damaging Het
Sectm1b A G 11: 120,945,768 (GRCm39) I191T possibly damaging Het
Septin4 A G 11: 87,458,061 (GRCm39) H145R possibly damaging Het
Setd1b T C 5: 123,285,676 (GRCm39) S241P unknown Het
Slco1a8 T C 6: 141,949,149 (GRCm39) M76V possibly damaging Het
Srpk2 T C 5: 23,729,148 (GRCm39) K497R probably benign Het
Sspo T C 6: 48,467,940 (GRCm39) S4296P probably damaging Het
Syne4 T C 7: 30,016,308 (GRCm39) V168A probably benign Het
Tank T C 2: 61,480,256 (GRCm39) F264S probably damaging Het
Ticrr T C 7: 79,344,955 (GRCm39) S1607P probably damaging Het
Trim30a A G 7: 104,060,405 (GRCm39) V457A probably damaging Het
Trim43b T A 9: 88,967,624 (GRCm39) K336N probably damaging Het
Trim47 T C 11: 115,996,963 (GRCm39) Q598R probably damaging Het
Tspan12 T C 6: 21,851,022 (GRCm39) N18S probably damaging Het
Ubap2 A G 4: 41,221,607 (GRCm39) S231P probably benign Het
Vit A G 17: 78,930,175 (GRCm39) D380G probably damaging Het
Vmn2r2 T C 3: 64,041,942 (GRCm39) N258D possibly damaging Het
Vmn2r52 C T 7: 9,907,333 (GRCm39) C131Y possibly damaging Het
Zfp58 A T 13: 67,639,307 (GRCm39) F395I probably damaging Het
Zfp940 C A 7: 29,544,435 (GRCm39) G491C probably damaging Het
Other mutations in Crygd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL00640:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL00650:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL00654:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL00732:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL00755:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL00772:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL00788:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL00852:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL00861:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL00863:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL00864:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL00885:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL00886:Crygd APN 1 65,101,250 (GRCm39) missense probably benign 0.32
IGL01939:Crygd APN 1 65,101,185 (GRCm39) missense probably benign
L23 UTSW 1 65,102,243 (GRCm39) missense probably damaging 1.00
R1400:Crygd UTSW 1 65,102,367 (GRCm39) missense probably damaging 1.00
R1528:Crygd UTSW 1 65,102,216 (GRCm39) critical splice donor site probably null
R2077:Crygd UTSW 1 65,102,405 (GRCm39) missense probably damaging 1.00
R9308:Crygd UTSW 1 65,101,220 (GRCm39) missense probably benign 0.03
R9617:Crygd UTSW 1 65,102,369 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACCCTCTGTATGCATGAG -3'
(R):5'- TCACAGGATCAGACTGTACGAG -3'

Sequencing Primer
(F):5'- AGTGAGACCCTGTTTTGAACC -3'
(R):5'- TCAGACTGTACGAGAGGGAAGAGTAC -3'
Posted On 2014-06-23