Mutagenetix > Incidental Mutation

Incidental Mutation 'R1862:Crygd'

203982

Institutional Source

Beutler Lab

Gene Symbol

Crygd

Ensembl Gene

ENSMUSG00000067299

Gene Name

crystallin, gamma D

Synonyms

Cryg-1, DGcry-1, Aey4

MMRRC Submission

039885-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.269) question?

Stock #

R1862 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

65061872-65063452 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65061974 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 154 (Y154C)

Ref Sequence

ENSEMBL: ENSMUSP00000045327 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045028] [ENSMUST00000146122]

AlphaFold

P04342

Predicted Effect

probably benign
Transcript: ENSMUST00000045028
AA Change: Y154C

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000045327
Gene: ENSMUSG00000067299
AA Change: Y154C

Domain	Start	End	E-Value	Type
XTALbg	3	82	3.23e-45	SMART
XTALbg	89	170	4.09e-47	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127762

Predicted Effect

probably benign
Transcript: ENSMUST00000146122

SMART Domains

Protein: ENSMUSP00000122528
Gene: ENSMUSG00000067299

Domain	Start	End	E-Value	Type
XTALbg	1	79	1.77e-42	SMART

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.9%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. Four gamma-crystallin genes (gamma-A through gamma-D) and three pseudogenes (gamma-E, gamma-F, gamma-G) are tandemly organized in a genomic segment as a gene cluster. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygotes for a spontaneous mutation exhibit a dense nuclear cataract and mild microphthalmia by 2-months of age, followed by posterior capsular rupture into the posterior vitreous by 3-months. In homozygotes, the microphthalmia is more pronounced. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	A	14: 8,241,416	E565D	probably benign	Het
Adam30	A	T	3: 98,162,113	K421*	probably null	Het
Atp6v1b1	A	G	6: 83,749,852		probably null	Het
Cacna1a	A	T	8: 84,415,930	I96F	possibly damaging	Het
Card10	G	A	15: 78,780,514	R747W	probably damaging	Het
Cdh8	T	A	8: 99,190,394	D363V	probably damaging	Het
Cecr2	T	C	6: 120,757,941	Y685H	probably damaging	Het
Cmklr1	T	C	5: 113,614,407	T178A	probably damaging	Het
Col16a1	G	A	4: 130,092,782		probably null	Het
Col4a1	C	T	8: 11,226,439		probably benign	Het
Coro2a	T	A	4: 46,548,797	I166F	possibly damaging	Het
Cry2	T	C	2: 92,424,566	H148R	probably damaging	Het
Cubn	T	C	2: 13,308,561	Y3066C	probably damaging	Het
Defb15	C	T	8: 21,929,986	E42K	possibly damaging	Het
Dnah12	A	G	14: 26,697,398	D147G	probably benign	Het
Dnah12	A	T	14: 26,709,257	Y340F	probably benign	Het
Dot1l	G	T	10: 80,783,539	R193L	probably damaging	Het
Dupd1	A	G	14: 21,686,689	V115A	probably benign	Het
Esd	A	C	14: 74,742,074	Y119S	probably damaging	Het
Esp36	A	G	17: 38,419,439		probably benign	Het
Etfbkmt	T	A	6: 149,144,151	M1K	probably null	Het
Exph5	A	G	9: 53,376,248	H1543R	probably benign	Het
Fam92a	C	T	4: 12,155,717	V306I	possibly damaging	Het
Fbxo16	A	G	14: 65,270,803	T23A	probably damaging	Het
Gm11492	A	G	11: 87,567,235	H145R	possibly damaging	Het
Gm6614	T	C	6: 142,003,423	M76V	possibly damaging	Het
Gorasp2	C	A	2: 70,679,464	H136Q	probably damaging	Het
Hdc	T	A	2: 126,597,933	I367F	probably benign	Het
Hmcn1	C	T	1: 150,638,900	V3574M	probably benign	Het
Ilvbl	A	G	10: 78,584,124	D592G	probably benign	Het
Inmt	G	A	6: 55,174,883	A34V	probably damaging	Het
Ints9	A	C	14: 65,026,413	H378P	probably benign	Het
Kcnh7	T	A	2: 62,787,754	I464L	possibly damaging	Het
Kcnt2	T	A	1: 140,425,330	V259D	probably damaging	Het
Lipo1	A	G	19: 33,784,692	F135S	probably damaging	Het
Lrba	T	C	3: 86,773,203		probably null	Het
Mapk1	T	A	16: 17,026,429	S22T	probably benign	Het
Mbd3l2	T	C	9: 18,444,921	S181P	possibly damaging	Het
Mgat5	C	T	1: 127,459,969	P554L	probably damaging	Het
Mki67	T	C	7: 135,699,361	T1315A	probably benign	Het
Mprip	C	T	11: 59,758,221	T917M	possibly damaging	Het
Mroh3	T	A	1: 136,185,988	I688F	probably benign	Het
Myo1d	A	T	11: 80,663,048	Y536N	probably damaging	Het
Neb	C	T	2: 52,162,187		probably null	Het
Noc2l	A	G	4: 156,237,708	R161G	probably benign	Het
Nup54	T	A	5: 92,419,567	I375L	possibly damaging	Het
Nup93	T	C	8: 94,306,102	F539L	probably damaging	Het
Olfr138	A	G	17: 38,275,344	E191G	probably damaging	Het
Olfr417	T	A	1: 174,369,452	H178Q	probably damaging	Het
Olfr480	A	C	7: 108,066,725	Y24*	probably null	Het
Olfr874	T	A	9: 37,746,968	M278K	probably benign	Het
Panx1	A	T	9: 15,007,428	D378E	probably damaging	Het
Papss1	T	A	3: 131,583,184	V170D	possibly damaging	Het
Pcnx	T	C	12: 81,918,732	S558P	probably damaging	Het
Pde3a	T	A	6: 141,250,353	I255N	probably damaging	Het
Pde3a	G	T	6: 141,487,513	A757S	probably damaging	Het
Pdzph1	A	G	17: 58,922,583	Y1027H	probably damaging	Het
Pkhd1	G	T	1: 20,551,020	R805S	probably benign	Het
Polr1a	G	A	6: 71,909,203	G14D	probably damaging	Het
Prg4	T	A	1: 150,460,669	D60V	probably damaging	Het
Ptprc	T	C	1: 138,112,227	S311G	probably benign	Het
Rapgefl1	G	A	11: 98,842,209	R205K	probably benign	Het
Rcan2	A	T	17: 44,037,089		probably null	Het
Rock1	A	G	18: 10,079,207	I1087T	probably damaging	Het
Sectm1b	A	G	11: 121,054,942	I191T	possibly damaging	Het
Setd1b	T	C	5: 123,147,613	S241P	unknown	Het
Srpk2	T	C	5: 23,524,150	K497R	probably benign	Het
Sspo	T	C	6: 48,491,006	S4296P	probably damaging	Het
Syne4	T	C	7: 30,316,883	V168A	probably benign	Het
Tank	T	C	2: 61,649,912	F264S	probably damaging	Het
Ticrr	T	C	7: 79,695,207	S1607P	probably damaging	Het
Trim30a	A	G	7: 104,411,198	V457A	probably damaging	Het
Trim43b	T	A	9: 89,085,571	K336N	probably damaging	Het
Trim47	T	C	11: 116,106,137	Q598R	probably damaging	Het
Tspan12	T	C	6: 21,851,023	N18S	probably damaging	Het
Ubap2	A	G	4: 41,221,607	S231P	probably benign	Het
Vit	A	G	17: 78,622,746	D380G	probably damaging	Het
Vmn2r2	T	C	3: 64,134,521	N258D	possibly damaging	Het
Vmn2r52	C	T	7: 10,173,406	C131Y	possibly damaging	Het
Zadh2	T	C	18: 84,095,318	V373A	possibly damaging	Het
Zfp58	A	T	13: 67,491,188	F395I	probably damaging	Het
Zfp940	C	A	7: 29,845,010	G491C	probably damaging	Het

Other mutations in Crygd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL00640:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL00650:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL00654:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL00732:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL00755:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL00772:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL00788:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL00852:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL00861:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL00863:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL00864:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL00885:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL00886:Crygd	APN	1	65062091	missense	probably benign	0.32
IGL01939:Crygd	APN	1	65062026	missense	probably benign
L23	UTSW	1	65063084	missense	probably damaging	1.00
R1400:Crygd	UTSW	1	65063208	missense	probably damaging	1.00
R1528:Crygd	UTSW	1	65063057	critical splice donor site	probably null
R2077:Crygd	UTSW	1	65063246	missense	probably damaging	1.00
R9308:Crygd	UTSW	1	65062061	missense	probably benign	0.03
R9617:Crygd	UTSW	1	65063210	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCACCCTCTGTATGCATGAG -3'
(R):5'- TCACAGGATCAGACTGTACGAG -3'

Sequencing Primer
(F):5'- AGTGAGACCCTGTTTTGAACC -3'
(R):5'- TCAGACTGTACGAGAGGGAAGAGTAC -3'

Posted On

2014-06-23