Mutagenetix > Incidental Mutation

Incidental Mutation 'R1862:Mgat5'

203983

Institutional Source

Beutler Lab

Gene Symbol

Mgat5

Ensembl Gene

ENSMUSG00000036155

Gene Name

mannoside acetylglucosaminyltransferase 5

Synonyms

4930471A21Rik, beta1,6N-acetylglucosaminyltransferase V, GlcNAc-TV, 5330407H02Rik

MMRRC Submission

039885-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1862 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

127205015-127488336 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 127459969 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 554 (P554L)

Ref Sequence

ENSEMBL: ENSMUSP00000129166 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405]

AlphaFold

Q8R4G6

Predicted Effect

probably damaging
Transcript: ENSMUST00000038361
AA Change: P554L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155
AA Change: P554L

Domain	Start	End	E-Value	Type
Pfam:DUF4525	2	138	3.4e-70	PFAM
Pfam:Glyco_transf_18	171	725	9.8e-268	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000171405
AA Change: P554L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155
AA Change: P554L

Domain	Start	End	E-Value	Type
Pfam:DUF4525	3	137	9.3e-64	PFAM
Pfam:Glyco_transf_18	171	725	1.9e-268	PFAM

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.9%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	A	14: 8,241,416	E565D	probably benign	Het
Adam30	A	T	3: 98,162,113	K421*	probably null	Het
Atp6v1b1	A	G	6: 83,749,852		probably null	Het
Cacna1a	A	T	8: 84,415,930	I96F	possibly damaging	Het
Card10	G	A	15: 78,780,514	R747W	probably damaging	Het
Cdh8	T	A	8: 99,190,394	D363V	probably damaging	Het
Cecr2	T	C	6: 120,757,941	Y685H	probably damaging	Het
Cmklr1	T	C	5: 113,614,407	T178A	probably damaging	Het
Col16a1	G	A	4: 130,092,782		probably null	Het
Col4a1	C	T	8: 11,226,439		probably benign	Het
Coro2a	T	A	4: 46,548,797	I166F	possibly damaging	Het
Cry2	T	C	2: 92,424,566	H148R	probably damaging	Het
Crygd	T	C	1: 65,061,974	Y154C	probably benign	Het
Cubn	T	C	2: 13,308,561	Y3066C	probably damaging	Het
Defb15	C	T	8: 21,929,986	E42K	possibly damaging	Het
Dnah12	A	G	14: 26,697,398	D147G	probably benign	Het
Dnah12	A	T	14: 26,709,257	Y340F	probably benign	Het
Dot1l	G	T	10: 80,783,539	R193L	probably damaging	Het
Dupd1	A	G	14: 21,686,689	V115A	probably benign	Het
Esd	A	C	14: 74,742,074	Y119S	probably damaging	Het
Esp36	A	G	17: 38,419,439		probably benign	Het
Etfbkmt	T	A	6: 149,144,151	M1K	probably null	Het
Exph5	A	G	9: 53,376,248	H1543R	probably benign	Het
Fam92a	C	T	4: 12,155,717	V306I	possibly damaging	Het
Fbxo16	A	G	14: 65,270,803	T23A	probably damaging	Het
Gm11492	A	G	11: 87,567,235	H145R	possibly damaging	Het
Gm6614	T	C	6: 142,003,423	M76V	possibly damaging	Het
Gorasp2	C	A	2: 70,679,464	H136Q	probably damaging	Het
Hdc	T	A	2: 126,597,933	I367F	probably benign	Het
Hmcn1	C	T	1: 150,638,900	V3574M	probably benign	Het
Ilvbl	A	G	10: 78,584,124	D592G	probably benign	Het
Inmt	G	A	6: 55,174,883	A34V	probably damaging	Het
Ints9	A	C	14: 65,026,413	H378P	probably benign	Het
Kcnh7	T	A	2: 62,787,754	I464L	possibly damaging	Het
Kcnt2	T	A	1: 140,425,330	V259D	probably damaging	Het
Lipo1	A	G	19: 33,784,692	F135S	probably damaging	Het
Lrba	T	C	3: 86,773,203		probably null	Het
Mapk1	T	A	16: 17,026,429	S22T	probably benign	Het
Mbd3l2	T	C	9: 18,444,921	S181P	possibly damaging	Het
Mki67	T	C	7: 135,699,361	T1315A	probably benign	Het
Mprip	C	T	11: 59,758,221	T917M	possibly damaging	Het
Mroh3	T	A	1: 136,185,988	I688F	probably benign	Het
Myo1d	A	T	11: 80,663,048	Y536N	probably damaging	Het
Neb	C	T	2: 52,162,187		probably null	Het
Noc2l	A	G	4: 156,237,708	R161G	probably benign	Het
Nup54	T	A	5: 92,419,567	I375L	possibly damaging	Het
Nup93	T	C	8: 94,306,102	F539L	probably damaging	Het
Olfr138	A	G	17: 38,275,344	E191G	probably damaging	Het
Olfr417	T	A	1: 174,369,452	H178Q	probably damaging	Het
Olfr480	A	C	7: 108,066,725	Y24*	probably null	Het
Olfr874	T	A	9: 37,746,968	M278K	probably benign	Het
Panx1	A	T	9: 15,007,428	D378E	probably damaging	Het
Papss1	T	A	3: 131,583,184	V170D	possibly damaging	Het
Pcnx	T	C	12: 81,918,732	S558P	probably damaging	Het
Pde3a	T	A	6: 141,250,353	I255N	probably damaging	Het
Pde3a	G	T	6: 141,487,513	A757S	probably damaging	Het
Pdzph1	A	G	17: 58,922,583	Y1027H	probably damaging	Het
Pkhd1	G	T	1: 20,551,020	R805S	probably benign	Het
Polr1a	G	A	6: 71,909,203	G14D	probably damaging	Het
Prg4	T	A	1: 150,460,669	D60V	probably damaging	Het
Ptprc	T	C	1: 138,112,227	S311G	probably benign	Het
Rapgefl1	G	A	11: 98,842,209	R205K	probably benign	Het
Rcan2	A	T	17: 44,037,089		probably null	Het
Rock1	A	G	18: 10,079,207	I1087T	probably damaging	Het
Sectm1b	A	G	11: 121,054,942	I191T	possibly damaging	Het
Setd1b	T	C	5: 123,147,613	S241P	unknown	Het
Srpk2	T	C	5: 23,524,150	K497R	probably benign	Het
Sspo	T	C	6: 48,491,006	S4296P	probably damaging	Het
Syne4	T	C	7: 30,316,883	V168A	probably benign	Het
Tank	T	C	2: 61,649,912	F264S	probably damaging	Het
Ticrr	T	C	7: 79,695,207	S1607P	probably damaging	Het
Trim30a	A	G	7: 104,411,198	V457A	probably damaging	Het
Trim43b	T	A	9: 89,085,571	K336N	probably damaging	Het
Trim47	T	C	11: 116,106,137	Q598R	probably damaging	Het
Tspan12	T	C	6: 21,851,023	N18S	probably damaging	Het
Ubap2	A	G	4: 41,221,607	S231P	probably benign	Het
Vit	A	G	17: 78,622,746	D380G	probably damaging	Het
Vmn2r2	T	C	3: 64,134,521	N258D	possibly damaging	Het
Vmn2r52	C	T	7: 10,173,406	C131Y	possibly damaging	Het
Zadh2	T	C	18: 84,095,318	V373A	possibly damaging	Het
Zfp58	A	T	13: 67,491,188	F395I	probably damaging	Het
Zfp940	C	A	7: 29,845,010	G491C	probably damaging	Het

Other mutations in Mgat5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Mgat5	APN	1	127387467	missense	probably damaging	1.00
IGL00813:Mgat5	APN	1	127384806	missense	probably benign
IGL01795:Mgat5	APN	1	127469231	missense	probably damaging	0.98
IGL01830:Mgat5	APN	1	127412132	missense	probably damaging	1.00
IGL01879:Mgat5	APN	1	127397550	missense	probably damaging	0.99
IGL02322:Mgat5	APN	1	127382985	missense	probably benign	0.00
IGL02621:Mgat5	APN	1	127397589	missense	possibly damaging	0.86
IGL02695:Mgat5	APN	1	127412131	missense	probably damaging	1.00
IGL03142:Mgat5	APN	1	127412223	missense	probably damaging	1.00
Cowlick	UTSW	1	127471564	missense	probably benign	0.36
Curls	UTSW	1	127320634	missense	possibly damaging	0.77
R0518:Mgat5	UTSW	1	127384847	missense	probably damaging	1.00
R0594:Mgat5	UTSW	1	127412248	missense	probably damaging	0.96
R1480:Mgat5	UTSW	1	127459979	missense	probably damaging	1.00
R1501:Mgat5	UTSW	1	127397641	critical splice donor site	probably null
R1712:Mgat5	UTSW	1	127320638	missense	probably benign	0.34
R1744:Mgat5	UTSW	1	127479469	missense	probably damaging	1.00
R1994:Mgat5	UTSW	1	127459959	missense	possibly damaging	0.82
R2054:Mgat5	UTSW	1	127397607	missense	probably damaging	1.00
R2150:Mgat5	UTSW	1	127469250	missense	probably damaging	1.00
R2303:Mgat5	UTSW	1	127446299	missense	probably benign	0.00
R2566:Mgat5	UTSW	1	127307004	missense	probably benign	0.01
R3498:Mgat5	UTSW	1	127384834	missense	possibly damaging	0.55
R3788:Mgat5	UTSW	1	127366443	missense	probably benign
R4674:Mgat5	UTSW	1	127390758	missense	probably damaging	1.00
R4873:Mgat5	UTSW	1	127469249	missense	probably damaging	1.00
R4875:Mgat5	UTSW	1	127469249	missense	probably damaging	1.00
R5175:Mgat5	UTSW	1	127459912	missense	probably damaging	0.97
R5310:Mgat5	UTSW	1	127387514	critical splice donor site	probably null
R5337:Mgat5	UTSW	1	127459921	missense	possibly damaging	0.84
R5597:Mgat5	UTSW	1	127397566	missense	probably damaging	1.00
R5599:Mgat5	UTSW	1	127397566	missense	probably damaging	1.00
R5861:Mgat5	UTSW	1	127387392	missense	probably damaging	1.00
R5956:Mgat5	UTSW	1	127382939	missense	probably benign	0.10
R6042:Mgat5	UTSW	1	127459899	missense	probably damaging	1.00
R6223:Mgat5	UTSW	1	127382979	missense	possibly damaging	0.86
R6492:Mgat5	UTSW	1	127471564	missense	probably benign	0.36
R6662:Mgat5	UTSW	1	127469237	missense	probably damaging	1.00
R6960:Mgat5	UTSW	1	127320634	missense	possibly damaging	0.77
R6981:Mgat5	UTSW	1	127390851	missense	probably damaging	0.98
R7110:Mgat5	UTSW	1	127382979	missense	possibly damaging	0.92
R7133:Mgat5	UTSW	1	127365189	missense	probably benign
R7142:Mgat5	UTSW	1	127412187	missense	probably damaging	1.00
R7151:Mgat5	UTSW	1	127446262	missense	probably damaging	0.97
R7506:Mgat5	UTSW	1	127366455	missense	probably benign	0.24
R7790:Mgat5	UTSW	1	127412204	missense	probably benign	0.23
R7980:Mgat5	UTSW	1	127479511	missense	probably benign	0.13
R8548:Mgat5	UTSW	1	127320672	missense	possibly damaging	0.77
R9008:Mgat5	UTSW	1	127479571	missense	probably damaging	1.00
R9127:Mgat5	UTSW	1	127366460	missense	probably benign	0.14
R9279:Mgat5	UTSW	1	127397611	missense	probably damaging	1.00
R9599:Mgat5	UTSW	1	127320708	missense	probably benign	0.02
X0028:Mgat5	UTSW	1	127366485	missense	possibly damaging	0.91
Z1177:Mgat5	UTSW	1	127482692	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGTCTGACTGGTATCTCCATG -3'
(R):5'- AACCTGTGTGGAACTCCTCC -3'

Sequencing Primer
(F):5'- ACTGGTATCTCCATGTGATGTC -3'
(R):5'- GTCAAATCAGTGAGCTCTGAGTTCAG -3'

Posted On

2014-06-23