Incidental Mutation 'R1862:Mgat5'
ID 203983
Institutional Source Beutler Lab
Gene Symbol Mgat5
Ensembl Gene ENSMUSG00000036155
Gene Name mannoside acetylglucosaminyltransferase 5
Synonyms 4930471A21Rik, 5330407H02Rik, GlcNAc-TV, beta1,6N-acetylglucosaminyltransferase V
MMRRC Submission 039885-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1862 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 127132450-127413760 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 127387706 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 554 (P554L)
Ref Sequence ENSEMBL: ENSMUSP00000129166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405]
AlphaFold Q8R4G6
Predicted Effect probably damaging
Transcript: ENSMUST00000038361
AA Change: P554L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155
AA Change: P554L

DomainStartEndE-ValueType
Pfam:DUF4525 2 138 3.4e-70 PFAM
Pfam:Glyco_transf_18 171 725 9.8e-268 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171405
AA Change: P554L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155
AA Change: P554L

DomainStartEndE-ValueType
Pfam:DUF4525 3 137 9.3e-64 PFAM
Pfam:Glyco_transf_18 171 725 1.9e-268 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 (GRCm38) E565D probably benign Het
Adam30 A T 3: 98,069,429 (GRCm39) K421* probably null Het
Atp6v1b1 A G 6: 83,726,834 (GRCm39) probably null Het
Cacna1a A T 8: 85,142,559 (GRCm39) I96F possibly damaging Het
Card10 G A 15: 78,664,714 (GRCm39) R747W probably damaging Het
Cdh8 T A 8: 99,917,026 (GRCm39) D363V probably damaging Het
Cecr2 T C 6: 120,734,902 (GRCm39) Y685H probably damaging Het
Cibar1 C T 4: 12,155,717 (GRCm39) V306I possibly damaging Het
Cmklr1 T C 5: 113,752,468 (GRCm39) T178A probably damaging Het
Col16a1 G A 4: 129,986,575 (GRCm39) probably null Het
Col4a1 C T 8: 11,276,439 (GRCm39) probably benign Het
Coro2a T A 4: 46,548,797 (GRCm39) I166F possibly damaging Het
Cry2 T C 2: 92,254,911 (GRCm39) H148R probably damaging Het
Crygd T C 1: 65,101,133 (GRCm39) Y154C probably benign Het
Cubn T C 2: 13,313,372 (GRCm39) Y3066C probably damaging Het
Defb15 C T 8: 22,420,002 (GRCm39) E42K possibly damaging Het
Dnah12 A G 14: 26,418,553 (GRCm39) D147G probably benign Het
Dnah12 A T 14: 26,430,412 (GRCm39) Y340F probably benign Het
Dot1l G T 10: 80,619,373 (GRCm39) R193L probably damaging Het
Dusp29 A G 14: 21,736,757 (GRCm39) V115A probably benign Het
Esd A C 14: 74,979,514 (GRCm39) Y119S probably damaging Het
Esp36 A G 17: 38,730,330 (GRCm39) probably benign Het
Etfbkmt T A 6: 149,045,649 (GRCm39) M1K probably null Het
Exph5 A G 9: 53,287,548 (GRCm39) H1543R probably benign Het
Fbxo16 A G 14: 65,508,252 (GRCm39) T23A probably damaging Het
Gorasp2 C A 2: 70,509,808 (GRCm39) H136Q probably damaging Het
Hdc T A 2: 126,439,853 (GRCm39) I367F probably benign Het
Hmcn1 C T 1: 150,514,651 (GRCm39) V3574M probably benign Het
Ilvbl A G 10: 78,419,958 (GRCm39) D592G probably benign Het
Inmt G A 6: 55,151,868 (GRCm39) A34V probably damaging Het
Ints9 A C 14: 65,263,862 (GRCm39) H378P probably benign Het
Kcnh7 T A 2: 62,618,098 (GRCm39) I464L possibly damaging Het
Kcnt2 T A 1: 140,353,068 (GRCm39) V259D probably damaging Het
Lipo3 A G 19: 33,762,092 (GRCm39) F135S probably damaging Het
Lrba T C 3: 86,680,510 (GRCm39) probably null Het
Mapk1 T A 16: 16,844,293 (GRCm39) S22T probably benign Het
Mbd3l2 T C 9: 18,356,217 (GRCm39) S181P possibly damaging Het
Mki67 T C 7: 135,301,090 (GRCm39) T1315A probably benign Het
Mprip C T 11: 59,649,047 (GRCm39) T917M possibly damaging Het
Mroh3 T A 1: 136,113,726 (GRCm39) I688F probably benign Het
Myo1d A T 11: 80,553,874 (GRCm39) Y536N probably damaging Het
Neb C T 2: 52,052,199 (GRCm39) probably null Het
Noc2l A G 4: 156,322,165 (GRCm39) R161G probably benign Het
Nup54 T A 5: 92,567,426 (GRCm39) I375L possibly damaging Het
Nup93 T C 8: 95,032,730 (GRCm39) F539L probably damaging Het
Or10x1 T A 1: 174,197,018 (GRCm39) H178Q probably damaging Het
Or2n1e A G 17: 38,586,235 (GRCm39) E191G probably damaging Het
Or5p57 A C 7: 107,665,932 (GRCm39) Y24* probably null Het
Or8b12 T A 9: 37,658,264 (GRCm39) M278K probably benign Het
Panx1 A T 9: 14,918,724 (GRCm39) D378E probably damaging Het
Papss1 T A 3: 131,288,945 (GRCm39) V170D possibly damaging Het
Pcnx1 T C 12: 81,965,506 (GRCm39) S558P probably damaging Het
Pde3a G T 6: 141,433,239 (GRCm39) A757S probably damaging Het
Pde3a T A 6: 141,196,079 (GRCm39) I255N probably damaging Het
Pdzph1 A G 17: 59,229,578 (GRCm39) Y1027H probably damaging Het
Pkhd1 G T 1: 20,621,244 (GRCm39) R805S probably benign Het
Polr1a G A 6: 71,886,187 (GRCm39) G14D probably damaging Het
Prg4 T A 1: 150,336,420 (GRCm39) D60V probably damaging Het
Ptgr3 T C 18: 84,113,443 (GRCm39) V373A possibly damaging Het
Ptprc T C 1: 138,039,965 (GRCm39) S311G probably benign Het
Rapgefl1 G A 11: 98,733,035 (GRCm39) R205K probably benign Het
Rcan2 A T 17: 44,347,980 (GRCm39) probably null Het
Rock1 A G 18: 10,079,207 (GRCm39) I1087T probably damaging Het
Sectm1b A G 11: 120,945,768 (GRCm39) I191T possibly damaging Het
Septin4 A G 11: 87,458,061 (GRCm39) H145R possibly damaging Het
Setd1b T C 5: 123,285,676 (GRCm39) S241P unknown Het
Slco1a8 T C 6: 141,949,149 (GRCm39) M76V possibly damaging Het
Srpk2 T C 5: 23,729,148 (GRCm39) K497R probably benign Het
Sspo T C 6: 48,467,940 (GRCm39) S4296P probably damaging Het
Syne4 T C 7: 30,016,308 (GRCm39) V168A probably benign Het
Tank T C 2: 61,480,256 (GRCm39) F264S probably damaging Het
Ticrr T C 7: 79,344,955 (GRCm39) S1607P probably damaging Het
Trim30a A G 7: 104,060,405 (GRCm39) V457A probably damaging Het
Trim43b T A 9: 88,967,624 (GRCm39) K336N probably damaging Het
Trim47 T C 11: 115,996,963 (GRCm39) Q598R probably damaging Het
Tspan12 T C 6: 21,851,022 (GRCm39) N18S probably damaging Het
Ubap2 A G 4: 41,221,607 (GRCm39) S231P probably benign Het
Vit A G 17: 78,930,175 (GRCm39) D380G probably damaging Het
Vmn2r2 T C 3: 64,041,942 (GRCm39) N258D possibly damaging Het
Vmn2r52 C T 7: 9,907,333 (GRCm39) C131Y possibly damaging Het
Zfp58 A T 13: 67,639,307 (GRCm39) F395I probably damaging Het
Zfp940 C A 7: 29,544,435 (GRCm39) G491C probably damaging Het
Other mutations in Mgat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Mgat5 APN 1 127,315,204 (GRCm39) missense probably damaging 1.00
IGL00813:Mgat5 APN 1 127,312,543 (GRCm39) missense probably benign
IGL01795:Mgat5 APN 1 127,396,968 (GRCm39) missense probably damaging 0.98
IGL01830:Mgat5 APN 1 127,339,869 (GRCm39) missense probably damaging 1.00
IGL01879:Mgat5 APN 1 127,325,287 (GRCm39) missense probably damaging 0.99
IGL02322:Mgat5 APN 1 127,310,722 (GRCm39) missense probably benign 0.00
IGL02621:Mgat5 APN 1 127,325,326 (GRCm39) missense possibly damaging 0.86
IGL02695:Mgat5 APN 1 127,339,868 (GRCm39) missense probably damaging 1.00
IGL03142:Mgat5 APN 1 127,339,960 (GRCm39) missense probably damaging 1.00
Cowlick UTSW 1 127,399,301 (GRCm39) missense probably benign 0.36
Curls UTSW 1 127,248,371 (GRCm39) missense possibly damaging 0.77
R0518:Mgat5 UTSW 1 127,312,584 (GRCm39) missense probably damaging 1.00
R0594:Mgat5 UTSW 1 127,339,985 (GRCm39) missense probably damaging 0.96
R1480:Mgat5 UTSW 1 127,387,716 (GRCm39) missense probably damaging 1.00
R1501:Mgat5 UTSW 1 127,325,378 (GRCm39) critical splice donor site probably null
R1712:Mgat5 UTSW 1 127,248,375 (GRCm39) missense probably benign 0.34
R1744:Mgat5 UTSW 1 127,407,206 (GRCm39) missense probably damaging 1.00
R1994:Mgat5 UTSW 1 127,387,696 (GRCm39) missense possibly damaging 0.82
R2054:Mgat5 UTSW 1 127,325,344 (GRCm39) missense probably damaging 1.00
R2150:Mgat5 UTSW 1 127,396,987 (GRCm39) missense probably damaging 1.00
R2303:Mgat5 UTSW 1 127,374,036 (GRCm39) missense probably benign 0.00
R2566:Mgat5 UTSW 1 127,234,741 (GRCm39) missense probably benign 0.01
R3498:Mgat5 UTSW 1 127,312,571 (GRCm39) missense possibly damaging 0.55
R3788:Mgat5 UTSW 1 127,294,180 (GRCm39) missense probably benign
R4674:Mgat5 UTSW 1 127,318,495 (GRCm39) missense probably damaging 1.00
R4873:Mgat5 UTSW 1 127,396,986 (GRCm39) missense probably damaging 1.00
R4875:Mgat5 UTSW 1 127,396,986 (GRCm39) missense probably damaging 1.00
R5175:Mgat5 UTSW 1 127,387,649 (GRCm39) missense probably damaging 0.97
R5310:Mgat5 UTSW 1 127,315,251 (GRCm39) critical splice donor site probably null
R5337:Mgat5 UTSW 1 127,387,658 (GRCm39) missense possibly damaging 0.84
R5597:Mgat5 UTSW 1 127,325,303 (GRCm39) missense probably damaging 1.00
R5599:Mgat5 UTSW 1 127,325,303 (GRCm39) missense probably damaging 1.00
R5861:Mgat5 UTSW 1 127,315,129 (GRCm39) missense probably damaging 1.00
R5956:Mgat5 UTSW 1 127,310,676 (GRCm39) missense probably benign 0.10
R6042:Mgat5 UTSW 1 127,387,636 (GRCm39) missense probably damaging 1.00
R6223:Mgat5 UTSW 1 127,310,716 (GRCm39) missense possibly damaging 0.86
R6492:Mgat5 UTSW 1 127,399,301 (GRCm39) missense probably benign 0.36
R6662:Mgat5 UTSW 1 127,396,974 (GRCm39) missense probably damaging 1.00
R6960:Mgat5 UTSW 1 127,248,371 (GRCm39) missense possibly damaging 0.77
R6981:Mgat5 UTSW 1 127,318,588 (GRCm39) missense probably damaging 0.98
R7110:Mgat5 UTSW 1 127,310,716 (GRCm39) missense possibly damaging 0.92
R7133:Mgat5 UTSW 1 127,292,926 (GRCm39) missense probably benign
R7142:Mgat5 UTSW 1 127,339,924 (GRCm39) missense probably damaging 1.00
R7151:Mgat5 UTSW 1 127,373,999 (GRCm39) missense probably damaging 0.97
R7506:Mgat5 UTSW 1 127,294,192 (GRCm39) missense probably benign 0.24
R7790:Mgat5 UTSW 1 127,339,941 (GRCm39) missense probably benign 0.23
R7980:Mgat5 UTSW 1 127,407,248 (GRCm39) missense probably benign 0.13
R8548:Mgat5 UTSW 1 127,248,409 (GRCm39) missense possibly damaging 0.77
R9008:Mgat5 UTSW 1 127,407,308 (GRCm39) missense probably damaging 1.00
R9127:Mgat5 UTSW 1 127,294,197 (GRCm39) missense probably benign 0.14
R9279:Mgat5 UTSW 1 127,325,348 (GRCm39) missense probably damaging 1.00
R9599:Mgat5 UTSW 1 127,248,445 (GRCm39) missense probably benign 0.02
X0028:Mgat5 UTSW 1 127,294,222 (GRCm39) missense possibly damaging 0.91
Z1177:Mgat5 UTSW 1 127,410,429 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTCTGACTGGTATCTCCATG -3'
(R):5'- AACCTGTGTGGAACTCCTCC -3'

Sequencing Primer
(F):5'- ACTGGTATCTCCATGTGATGTC -3'
(R):5'- GTCAAATCAGTGAGCTCTGAGTTCAG -3'
Posted On 2014-06-23