Mutagenetix > Incidental Mutation

Incidental Mutation 'R1862:Ptprc'

203985

Institutional Source

Beutler Lab

Gene Symbol

Ptprc

Ensembl Gene

ENSMUSG00000026395

Gene Name

protein tyrosine phosphatase, receptor type, C

Synonyms

B220, Ly-5, Lyt-4, CD45, T200

MMRRC Submission

039885-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1862 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

138062861-138175708 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 138112227 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 311 (S311G)

Ref Sequence

ENSEMBL: ENSMUSP00000138350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000182283] [ENSMUST00000182755] [ENSMUST00000183301] [ENSMUST00000195533]

AlphaFold

P06800

Predicted Effect

probably benign
Transcript: ENSMUST00000027645
AA Change: S309G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000027645
Gene: ENSMUSG00000026395
AA Change: S309G

Domain	Start	End	E-Value	Type
Pfam:PTP_N	5	30	5e-16	PFAM
low complexity region	109	126	N/A	INTRINSIC
low complexity region	168	203	N/A	INTRINSIC
Pfam:CD45	210	267	3.1e-20	PFAM
FN3	372	456	2.28e0	SMART
FN3	472	550	3.48e-1	SMART
transmembrane domain	565	586	N/A	INTRINSIC
PTPc	639	901	7.57e-127	SMART
PTPc	930	1216	1.39e-102	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112036

SMART Domains

Protein: ENSMUSP00000107667
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	5	30	5.8e-13	PFAM
low complexity region	31	64	N/A	INTRINSIC
Pfam:CD45	70	129	1.8e-24	PFAM
FN3	233	317	2.28e0	SMART
FN3	333	411	3.48e-1	SMART
transmembrane domain	426	447	N/A	INTRINSIC
PTPc	500	762	7.57e-127	SMART
PTPc	791	1077	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182283
AA Change: S172G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000138800
Gene: ENSMUSG00000026395
AA Change: S172G

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	32	4.2e-13	PFAM
low complexity region	33	66	N/A	INTRINSIC
Pfam:CD45	72	131	2.3e-24	PFAM
FN3	235	319	2.28e0	SMART
FN3	335	413	3.48e-1	SMART
transmembrane domain	428	449	N/A	INTRINSIC
PTPc	502	764	7.57e-127	SMART
PTPc	793	1079	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182755
AA Change: S148G

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000138275
Gene: ENSMUSG00000026395
AA Change: S148G

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	34	5.5e-13	PFAM
Pfam:CD45	48	107	2.3e-24	PFAM
FN3	211	295	2.28e0	SMART
FN3	311	389	3.48e-1	SMART
transmembrane domain	404	425	N/A	INTRINSIC
PTPc	478	740	7.57e-127	SMART
PTPc	769	1055	1.39e-102	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000183301
AA Change: S311G

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000138350
Gene: ENSMUSG00000026395
AA Change: S311G

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	2.7e-13	PFAM
low complexity region	111	128	N/A	INTRINSIC
low complexity region	170	205	N/A	INTRINSIC
Pfam:CD45	211	270	2.1e-24	PFAM
FN3	374	458	2.28e0	SMART
FN3	474	552	3.48e-1	SMART
transmembrane domain	567	588	N/A	INTRINSIC
PTPc	641	903	7.57e-127	SMART
PTPc	932	1218	1.39e-102	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188596

Predicted Effect

probably benign
Transcript: ENSMUST00000195533

SMART Domains

Protein: ENSMUSP00000142052
Gene: ENSMUSG00000026395

Domain	Start	End	E-Value	Type
Pfam:PTP_N	7	33	7.4e-11	PFAM
low complexity region	68	115	N/A	INTRINSIC
Pfam:CD45	121	180	2.1e-22	PFAM

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.9%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitosis, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus is classified as a receptor type PTP. This PTP has been shown to be an essential regulator of T- and B-cell antigen receptor signaling. It functions through either direct interaction with components of the antigen receptor complexes, or by activating various Src family kinases required for the antigen receptor signaling. This PTP also suppresses JAK kinases, and thus functions as a regulator of cytokine receptor signaling. Alternatively spliced transcripts variants of this gene, which encode distinct isoforms, have been reported. [provided by RefSeq, Jun 2012]
PHENOTYPE: Homozygous null mutants have defective T cell, B cell, and NK cell morphology and physiology. Mice carrying an engineered point mutation exhibit lymphoproliferation and autoimmunity that leads to premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	A	14: 8,241,416	E565D	probably benign	Het
Adam30	A	T	3: 98,162,113	K421*	probably null	Het
Atp6v1b1	A	G	6: 83,749,852		probably null	Het
Cacna1a	A	T	8: 84,415,930	I96F	possibly damaging	Het
Card10	G	A	15: 78,780,514	R747W	probably damaging	Het
Cdh8	T	A	8: 99,190,394	D363V	probably damaging	Het
Cecr2	T	C	6: 120,757,941	Y685H	probably damaging	Het
Cmklr1	T	C	5: 113,614,407	T178A	probably damaging	Het
Col16a1	G	A	4: 130,092,782		probably null	Het
Col4a1	C	T	8: 11,226,439		probably benign	Het
Coro2a	T	A	4: 46,548,797	I166F	possibly damaging	Het
Cry2	T	C	2: 92,424,566	H148R	probably damaging	Het
Crygd	T	C	1: 65,061,974	Y154C	probably benign	Het
Cubn	T	C	2: 13,308,561	Y3066C	probably damaging	Het
Defb15	C	T	8: 21,929,986	E42K	possibly damaging	Het
Dnah12	A	G	14: 26,697,398	D147G	probably benign	Het
Dnah12	A	T	14: 26,709,257	Y340F	probably benign	Het
Dot1l	G	T	10: 80,783,539	R193L	probably damaging	Het
Dupd1	A	G	14: 21,686,689	V115A	probably benign	Het
Esd	A	C	14: 74,742,074	Y119S	probably damaging	Het
Esp36	A	G	17: 38,419,439		probably benign	Het
Etfbkmt	T	A	6: 149,144,151	M1K	probably null	Het
Exph5	A	G	9: 53,376,248	H1543R	probably benign	Het
Fam92a	C	T	4: 12,155,717	V306I	possibly damaging	Het
Fbxo16	A	G	14: 65,270,803	T23A	probably damaging	Het
Gm11492	A	G	11: 87,567,235	H145R	possibly damaging	Het
Gm6614	T	C	6: 142,003,423	M76V	possibly damaging	Het
Gorasp2	C	A	2: 70,679,464	H136Q	probably damaging	Het
Hdc	T	A	2: 126,597,933	I367F	probably benign	Het
Hmcn1	C	T	1: 150,638,900	V3574M	probably benign	Het
Ilvbl	A	G	10: 78,584,124	D592G	probably benign	Het
Inmt	G	A	6: 55,174,883	A34V	probably damaging	Het
Ints9	A	C	14: 65,026,413	H378P	probably benign	Het
Kcnh7	T	A	2: 62,787,754	I464L	possibly damaging	Het
Kcnt2	T	A	1: 140,425,330	V259D	probably damaging	Het
Lipo1	A	G	19: 33,784,692	F135S	probably damaging	Het
Lrba	T	C	3: 86,773,203		probably null	Het
Mapk1	T	A	16: 17,026,429	S22T	probably benign	Het
Mbd3l2	T	C	9: 18,444,921	S181P	possibly damaging	Het
Mgat5	C	T	1: 127,459,969	P554L	probably damaging	Het
Mki67	T	C	7: 135,699,361	T1315A	probably benign	Het
Mprip	C	T	11: 59,758,221	T917M	possibly damaging	Het
Mroh3	T	A	1: 136,185,988	I688F	probably benign	Het
Myo1d	A	T	11: 80,663,048	Y536N	probably damaging	Het
Neb	C	T	2: 52,162,187		probably null	Het
Noc2l	A	G	4: 156,237,708	R161G	probably benign	Het
Nup54	T	A	5: 92,419,567	I375L	possibly damaging	Het
Nup93	T	C	8: 94,306,102	F539L	probably damaging	Het
Olfr138	A	G	17: 38,275,344	E191G	probably damaging	Het
Olfr417	T	A	1: 174,369,452	H178Q	probably damaging	Het
Olfr480	A	C	7: 108,066,725	Y24*	probably null	Het
Olfr874	T	A	9: 37,746,968	M278K	probably benign	Het
Panx1	A	T	9: 15,007,428	D378E	probably damaging	Het
Papss1	T	A	3: 131,583,184	V170D	possibly damaging	Het
Pcnx	T	C	12: 81,918,732	S558P	probably damaging	Het
Pde3a	T	A	6: 141,250,353	I255N	probably damaging	Het
Pde3a	G	T	6: 141,487,513	A757S	probably damaging	Het
Pdzph1	A	G	17: 58,922,583	Y1027H	probably damaging	Het
Pkhd1	G	T	1: 20,551,020	R805S	probably benign	Het
Polr1a	G	A	6: 71,909,203	G14D	probably damaging	Het
Prg4	T	A	1: 150,460,669	D60V	probably damaging	Het
Rapgefl1	G	A	11: 98,842,209	R205K	probably benign	Het
Rcan2	A	T	17: 44,037,089		probably null	Het
Rock1	A	G	18: 10,079,207	I1087T	probably damaging	Het
Sectm1b	A	G	11: 121,054,942	I191T	possibly damaging	Het
Setd1b	T	C	5: 123,147,613	S241P	unknown	Het
Srpk2	T	C	5: 23,524,150	K497R	probably benign	Het
Sspo	T	C	6: 48,491,006	S4296P	probably damaging	Het
Syne4	T	C	7: 30,316,883	V168A	probably benign	Het
Tank	T	C	2: 61,649,912	F264S	probably damaging	Het
Ticrr	T	C	7: 79,695,207	S1607P	probably damaging	Het
Trim30a	A	G	7: 104,411,198	V457A	probably damaging	Het
Trim43b	T	A	9: 89,085,571	K336N	probably damaging	Het
Trim47	T	C	11: 116,106,137	Q598R	probably damaging	Het
Tspan12	T	C	6: 21,851,023	N18S	probably damaging	Het
Ubap2	A	G	4: 41,221,607	S231P	probably benign	Het
Vit	A	G	17: 78,622,746	D380G	probably damaging	Het
Vmn2r2	T	C	3: 64,134,521	N258D	possibly damaging	Het
Vmn2r52	C	T	7: 10,173,406	C131Y	possibly damaging	Het
Zadh2	T	C	18: 84,095,318	V373A	possibly damaging	Het
Zfp58	A	T	13: 67,491,188	F395I	probably damaging	Het
Zfp940	C	A	7: 29,845,010	G491C	probably damaging	Het

Other mutations in Ptprc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
lochy	APN	1	138083790	splice site	probably benign
IGL00486:Ptprc	APN	1	138115621	missense	probably damaging	0.97
IGL00771:Ptprc	APN	1	138113677	missense	probably benign	0.00
IGL00833:Ptprc	APN	1	138078492	missense	possibly damaging	0.55
IGL00919:Ptprc	APN	1	138113642	missense	probably damaging	1.00
IGL01020:Ptprc	APN	1	138120173	critical splice acceptor site	probably null	0.00
IGL01024:Ptprc	APN	1	138080912	missense	probably damaging	1.00
IGL01302:Ptprc	APN	1	138099631	missense	possibly damaging	0.82
IGL01548:Ptprc	APN	1	138099481	critical splice donor site	probably null	0.00
IGL01620:Ptprc	APN	1	138068410	missense	possibly damaging	0.88
IGL01775:Ptprc	APN	1	138064759	missense	probably damaging	1.00
IGL01820:Ptprc	APN	1	138066198	missense	probably damaging	1.00
IGL02340:Ptprc	APN	1	138071219	missense	probably damaging	1.00
IGL02943:Ptprc	APN	1	138099513	missense	probably damaging	0.99
IGL03169:Ptprc	APN	1	138113619	missense	probably benign	0.15
IGL03308:Ptprc	APN	1	138126320	missense	possibly damaging	0.70
IGL03404:Ptprc	APN	1	138093001	missense	probably damaging	1.00
belittle	UTSW	1	138137493	intron	probably benign
Benighted	UTSW	1	138126301	critical splice donor site	probably null
bletchley	UTSW	1	138117862	missense	probably benign
Blush	UTSW	1	138117720	intron	probably benign
bruise	UTSW	1	138064771	missense	probably damaging	1.00
chor_muang	UTSW	1	138113562	critical splice donor site	probably null
crystal	UTSW	1	138072255	critical splice donor site	probably null
Dumpling	UTSW	1	138067890	missense	probably damaging	1.00
fluorescent	UTSW	1	138101192	missense	probably damaging	0.97
fuchsia	UTSW	1	138101041	critical splice donor site	probably null
Gentian	UTSW	1	138067885	critical splice donor site	probably null
guotie	UTSW	1	138068401	nonsense	probably null
guotie2	UTSW	1	138094299	missense	probably damaging	0.97
Guotie3	UTSW	1	138078451	missense	possibly damaging	0.92
Gyoza	UTSW	1	138083567	missense	probably damaging	1.00
Half_measure	UTSW	1	138071249	missense	probably damaging	0.98
jirisan	UTSW	1	138113678	nonsense	probably null
mauve	UTSW	1	138099685	missense	probably benign
Perverse	UTSW	1	138101044	missense	probably benign	0.02
petechiae	UTSW	1	138113708	nonsense	probably null
ultra	UTSW	1	138078445	critical splice donor site	probably null
violaceous	UTSW	1	138083639	missense	possibly damaging	0.77
R0013:Ptprc	UTSW	1	138113559	splice site	probably null
R0189:Ptprc	UTSW	1	138082715	missense	probably benign	0.10
R0390:Ptprc	UTSW	1	138122575	missense	possibly damaging	0.71
R0504:Ptprc	UTSW	1	138088697	missense	probably damaging	1.00
R0602:Ptprc	UTSW	1	138089485	splice site	probably benign
R0627:Ptprc	UTSW	1	138068320	missense	probably damaging	0.99
R0632:Ptprc	UTSW	1	138073610	missense	probably benign	0.01
R0751:Ptprc	UTSW	1	138092930	missense	probably damaging	1.00
R0839:Ptprc	UTSW	1	138101132	missense	possibly damaging	0.47
R0942:Ptprc	UTSW	1	138068401	nonsense	probably null
R0943:Ptprc	UTSW	1	138111164	missense	probably damaging	0.96
R1159:Ptprc	UTSW	1	138072319	missense	probably damaging	1.00
R1442:Ptprc	UTSW	1	138072312	missense	probably damaging	1.00
R1489:Ptprc	UTSW	1	138120086	missense	possibly damaging	0.91
R1728:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1728:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1728:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1728:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1728:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1729:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1729:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1729:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1729:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1729:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1730:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1730:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1730:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1730:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1730:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1739:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1739:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1739:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1739:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1739:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1762:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1762:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1762:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1762:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1762:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1783:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1783:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1783:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1783:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1783:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1784:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1784:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1784:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1784:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1784:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R1785:Ptprc	UTSW	1	138099676	missense	probably benign	0.05
R1785:Ptprc	UTSW	1	138107823	missense	probably benign	0.22
R1785:Ptprc	UTSW	1	138107824	missense	probably benign	0.04
R1785:Ptprc	UTSW	1	138107837	missense	probably benign	0.09
R1785:Ptprc	UTSW	1	138112254	missense	possibly damaging	0.53
R2145:Ptprc	UTSW	1	138073681	missense	probably damaging	1.00
R2290:Ptprc	UTSW	1	138111188	missense	probably benign	0.00
R2403:Ptprc	UTSW	1	138088532	missense	probably damaging	1.00
R2439:Ptprc	UTSW	1	138066152	missense	possibly damaging	0.67
R2887:Ptprc	UTSW	1	138080178	missense	probably damaging	1.00
R2906:Ptprc	UTSW	1	138064534	missense	possibly damaging	0.93
R3774:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3775:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3776:Ptprc	UTSW	1	138064773	missense	probably damaging	0.97
R3834:Ptprc	UTSW	1	138083567	missense	probably damaging	1.00
R4019:Ptprc	UTSW	1	138078516	missense	probably damaging	1.00
R4377:Ptprc	UTSW	1	138067925	missense	probably benign	0.04
R4580:Ptprc	UTSW	1	138071251	missense	probably benign	0.09
R4923:Ptprc	UTSW	1	138078498	missense	possibly damaging	0.93
R4925:Ptprc	UTSW	1	138099497	missense	probably benign	0.04
R4937:Ptprc	UTSW	1	138089500	missense	probably damaging	1.00
R4970:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5112:Ptprc	UTSW	1	138094299	missense	probably damaging	0.97
R5145:Ptprc	UTSW	1	138089566	missense	probably benign	0.07
R5158:Ptprc	UTSW	1	138175084	missense	possibly damaging	0.75
R5223:Ptprc	UTSW	1	138117862	missense	probably benign
R5593:Ptprc	UTSW	1	138117720	intron	probably benign
R5689:Ptprc	UTSW	1	138117777	missense	probably benign	0.01
R5885:Ptprc	UTSW	1	138088508	missense	probably damaging	1.00
R6010:Ptprc	UTSW	1	138101056	missense	probably benign	0.09
R6026:Ptprc	UTSW	1	138071249	missense	probably damaging	0.98
R6047:Ptprc	UTSW	1	138101041	critical splice donor site	probably null
R6173:Ptprc	UTSW	1	138067890	missense	probably damaging	1.00
R6328:Ptprc	UTSW	1	138113678	nonsense	probably null
R6383:Ptprc	UTSW	1	138078451	missense	possibly damaging	0.92
R6436:Ptprc	UTSW	1	138083639	missense	possibly damaging	0.77
R6492:Ptprc	UTSW	1	138113562	critical splice donor site	probably null
R6520:Ptprc	UTSW	1	138080143	nonsense	probably null
R6805:Ptprc	UTSW	1	138067885	critical splice donor site	probably null
R6830:Ptprc	UTSW	1	138072255	critical splice donor site	probably null
R6847:Ptprc	UTSW	1	138088545	missense	probably damaging	0.99
R6960:Ptprc	UTSW	1	138078445	critical splice donor site	probably null
R6995:Ptprc	UTSW	1	138088744	missense	probably damaging	1.00
R7009:Ptprc	UTSW	1	138064553	missense	probably damaging	0.97
R7041:Ptprc	UTSW	1	138126309	missense	probably benign	0.04
R7055:Ptprc	UTSW	1	138089571	missense	probably damaging	1.00
R7098:Ptprc	UTSW	1	138099685	missense	probably benign
R7164:Ptprc	UTSW	1	138117862	missense	probably benign
R7188:Ptprc	UTSW	1	138071180	missense	probably damaging	1.00
R7191:Ptprc	UTSW	1	138101044	missense	probably benign	0.02
R7204:Ptprc	UTSW	1	138117862	missense	probably benign
R7316:Ptprc	UTSW	1	138064771	missense	probably damaging	1.00
R7644:Ptprc	UTSW	1	138067907	missense	probably benign	0.01
R7948:Ptprc	UTSW	1	138064576	missense	probably benign	0.45
R8029:Ptprc	UTSW	1	138078459	missense	probably damaging	1.00
R8677:Ptprc	UTSW	1	138083597	missense	probably damaging	1.00
R8704:Ptprc	UTSW	1	138115624	missense	probably benign	0.34
R8824:Ptprc	UTSW	1	138113708	nonsense	probably null
R8921:Ptprc	UTSW	1	138126301	critical splice donor site	probably null
R8998:Ptprc	UTSW	1	138101192	missense	probably damaging	0.97
R8999:Ptprc	UTSW	1	138101192	missense	probably damaging	0.97
R9154:Ptprc	UTSW	1	138088564	missense	probably damaging	1.00
R9388:Ptprc	UTSW	1	138083642	missense	possibly damaging	0.87
R9428:Ptprc	UTSW	1	138113747	missense	probably benign	0.01
R9467:Ptprc	UTSW	1	138066222	missense	probably damaging	1.00
R9468:Ptprc	UTSW	1	138117016	missense	probably benign	0.01
R9479:Ptprc	UTSW	1	138073650	missense	probably benign	0.38
R9526:Ptprc	UTSW	1	138068373	missense	probably benign	0.02
R9632:Ptprc	UTSW	1	138080889	missense	probably damaging	1.00
R9710:Ptprc	UTSW	1	138080889	missense	probably damaging	1.00
R9714:Ptprc	UTSW	1	138080949	missense	probably damaging	1.00
R9777:Ptprc	UTSW	1	138120163	missense
Z1177:Ptprc	UTSW	1	138067907	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTTTCAGTGCCAGAGATACTAGG -3'
(R):5'- AATCTCCTGCTTGCAAGACTG -3'

Sequencing Primer
(F):5'- CATTTAAGCCACGTCTGG -3'
(R):5'- GCTTGCAAGACTGTACTCCATGAG -3'

Posted On

2014-06-23