Incidental Mutation 'R1862:Prg4'
ID 203987
Institutional Source Beutler Lab
Gene Symbol Prg4
Ensembl Gene ENSMUSG00000006014
Gene Name proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Synonyms MSF, SZP, lubricin, DOL54
MMRRC Submission 039885-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R1862 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 150325163-150341916 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 150336420 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 60 (D60V)
Ref Sequence ENSEMBL: ENSMUSP00000107533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006171] [ENSMUST00000111901] [ENSMUST00000111902] [ENSMUST00000159035] [ENSMUST00000161320] [ENSMUST00000161611] [ENSMUST00000164600] [ENSMUST00000162367]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000006171
AA Change: D101V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006171
Gene: ENSMUSG00000006014
AA Change: D101V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111901
AA Change: D101V

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107532
Gene: ENSMUSG00000006014
AA Change: D101V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
low complexity region 141 151 N/A INTRINSIC
low complexity region 189 221 N/A INTRINSIC
low complexity region 241 535 N/A INTRINSIC
low complexity region 570 623 N/A INTRINSIC
HX 711 753 1.67e-7 SMART
HX 755 798 3.76e-10 SMART
Blast:HX 911 964 5e-27 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111902
AA Change: D60V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107533
Gene: ENSMUSG00000006014
AA Change: D60V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 86 143 N/A INTRINSIC
low complexity region 150 171 N/A INTRINSIC
low complexity region 188 198 N/A INTRINSIC
low complexity region 236 268 N/A INTRINSIC
low complexity region 288 582 N/A INTRINSIC
internal_repeat_1 588 614 2.72e-5 PROSPERO
low complexity region 617 670 N/A INTRINSIC
internal_repeat_1 680 706 2.72e-5 PROSPERO
HX 758 800 1.67e-7 SMART
HX 802 845 3.76e-10 SMART
Blast:HX 958 1011 4e-27 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000159035
AA Change: D60V

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124410
Gene: ENSMUSG00000006014
AA Change: D60V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 2.71e-15 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161320
AA Change: D60V

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124801
Gene: ENSMUSG00000006014
AA Change: D60V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 25 67 3.83e-15 SMART
low complexity region 69 83 N/A INTRINSIC
low complexity region 100 110 N/A INTRINSIC
low complexity region 148 179 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161611
AA Change: D101V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125677
Gene: ENSMUSG00000006014
AA Change: D101V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 578 691 2.2e-9 PFAM
internal_repeat_3 796 825 7.42e-5 PROSPERO
internal_repeat_2 797 823 1.24e-5 PROSPERO
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000164600
AA Change: D101V

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000128943
Gene: ENSMUSG00000006014
AA Change: D101V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 2.77e-12 SMART
low complexity region 110 122 N/A INTRINSIC
low complexity region 127 184 N/A INTRINSIC
low complexity region 191 212 N/A INTRINSIC
low complexity region 229 239 N/A INTRINSIC
internal_repeat_3 244 271 7.42e-5 PROSPERO
low complexity region 277 309 N/A INTRINSIC
Pfam:Cornifin 404 497 2.4e-14 PFAM
Pfam:Cornifin 468 584 3.2e-15 PFAM
Pfam:Cornifin 550 648 3.3e-16 PFAM
Pfam:Cornifin 625 722 2.1e-15 PFAM
Pfam:Cornifin 647 743 7.8e-16 PFAM
Pfam:Cornifin 706 822 1.4e-12 PFAM
low complexity region 826 879 N/A INTRINSIC
internal_repeat_2 889 915 1.24e-5 PROSPERO
HX 967 1009 1.67e-7 SMART
HX 1011 1054 3.76e-10 SMART
Blast:HX 1167 1220 6e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162367
AA Change: D101V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125551
Gene: ENSMUSG00000006014
AA Change: D101V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SO 26 68 9.21e-18 SMART
SO 69 108 4.21e-12 SMART
low complexity region 110 124 N/A INTRINSIC
HX 169 211 1.67e-7 SMART
HX 213 256 3.76e-10 SMART
Blast:HX 369 422 2e-27 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Aging homozygous null mice develop a hopping gait, irregular endochondral growth plates, altered cartilage surface, camptodactyly, progressive synovial hyperplasia and, ultimately, joint failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 (GRCm38) E565D probably benign Het
Adam30 A T 3: 98,069,429 (GRCm39) K421* probably null Het
Atp6v1b1 A G 6: 83,726,834 (GRCm39) probably null Het
Cacna1a A T 8: 85,142,559 (GRCm39) I96F possibly damaging Het
Card10 G A 15: 78,664,714 (GRCm39) R747W probably damaging Het
Cdh8 T A 8: 99,917,026 (GRCm39) D363V probably damaging Het
Cecr2 T C 6: 120,734,902 (GRCm39) Y685H probably damaging Het
Cibar1 C T 4: 12,155,717 (GRCm39) V306I possibly damaging Het
Cmklr1 T C 5: 113,752,468 (GRCm39) T178A probably damaging Het
Col16a1 G A 4: 129,986,575 (GRCm39) probably null Het
Col4a1 C T 8: 11,276,439 (GRCm39) probably benign Het
Coro2a T A 4: 46,548,797 (GRCm39) I166F possibly damaging Het
Cry2 T C 2: 92,254,911 (GRCm39) H148R probably damaging Het
Crygd T C 1: 65,101,133 (GRCm39) Y154C probably benign Het
Cubn T C 2: 13,313,372 (GRCm39) Y3066C probably damaging Het
Defb15 C T 8: 22,420,002 (GRCm39) E42K possibly damaging Het
Dnah12 A G 14: 26,418,553 (GRCm39) D147G probably benign Het
Dnah12 A T 14: 26,430,412 (GRCm39) Y340F probably benign Het
Dot1l G T 10: 80,619,373 (GRCm39) R193L probably damaging Het
Dusp29 A G 14: 21,736,757 (GRCm39) V115A probably benign Het
Esd A C 14: 74,979,514 (GRCm39) Y119S probably damaging Het
Esp36 A G 17: 38,730,330 (GRCm39) probably benign Het
Etfbkmt T A 6: 149,045,649 (GRCm39) M1K probably null Het
Exph5 A G 9: 53,287,548 (GRCm39) H1543R probably benign Het
Fbxo16 A G 14: 65,508,252 (GRCm39) T23A probably damaging Het
Gorasp2 C A 2: 70,509,808 (GRCm39) H136Q probably damaging Het
Hdc T A 2: 126,439,853 (GRCm39) I367F probably benign Het
Hmcn1 C T 1: 150,514,651 (GRCm39) V3574M probably benign Het
Ilvbl A G 10: 78,419,958 (GRCm39) D592G probably benign Het
Inmt G A 6: 55,151,868 (GRCm39) A34V probably damaging Het
Ints9 A C 14: 65,263,862 (GRCm39) H378P probably benign Het
Kcnh7 T A 2: 62,618,098 (GRCm39) I464L possibly damaging Het
Kcnt2 T A 1: 140,353,068 (GRCm39) V259D probably damaging Het
Lipo3 A G 19: 33,762,092 (GRCm39) F135S probably damaging Het
Lrba T C 3: 86,680,510 (GRCm39) probably null Het
Mapk1 T A 16: 16,844,293 (GRCm39) S22T probably benign Het
Mbd3l2 T C 9: 18,356,217 (GRCm39) S181P possibly damaging Het
Mgat5 C T 1: 127,387,706 (GRCm39) P554L probably damaging Het
Mki67 T C 7: 135,301,090 (GRCm39) T1315A probably benign Het
Mprip C T 11: 59,649,047 (GRCm39) T917M possibly damaging Het
Mroh3 T A 1: 136,113,726 (GRCm39) I688F probably benign Het
Myo1d A T 11: 80,553,874 (GRCm39) Y536N probably damaging Het
Neb C T 2: 52,052,199 (GRCm39) probably null Het
Noc2l A G 4: 156,322,165 (GRCm39) R161G probably benign Het
Nup54 T A 5: 92,567,426 (GRCm39) I375L possibly damaging Het
Nup93 T C 8: 95,032,730 (GRCm39) F539L probably damaging Het
Or10x1 T A 1: 174,197,018 (GRCm39) H178Q probably damaging Het
Or2n1e A G 17: 38,586,235 (GRCm39) E191G probably damaging Het
Or5p57 A C 7: 107,665,932 (GRCm39) Y24* probably null Het
Or8b12 T A 9: 37,658,264 (GRCm39) M278K probably benign Het
Panx1 A T 9: 14,918,724 (GRCm39) D378E probably damaging Het
Papss1 T A 3: 131,288,945 (GRCm39) V170D possibly damaging Het
Pcnx1 T C 12: 81,965,506 (GRCm39) S558P probably damaging Het
Pde3a G T 6: 141,433,239 (GRCm39) A757S probably damaging Het
Pde3a T A 6: 141,196,079 (GRCm39) I255N probably damaging Het
Pdzph1 A G 17: 59,229,578 (GRCm39) Y1027H probably damaging Het
Pkhd1 G T 1: 20,621,244 (GRCm39) R805S probably benign Het
Polr1a G A 6: 71,886,187 (GRCm39) G14D probably damaging Het
Ptgr3 T C 18: 84,113,443 (GRCm39) V373A possibly damaging Het
Ptprc T C 1: 138,039,965 (GRCm39) S311G probably benign Het
Rapgefl1 G A 11: 98,733,035 (GRCm39) R205K probably benign Het
Rcan2 A T 17: 44,347,980 (GRCm39) probably null Het
Rock1 A G 18: 10,079,207 (GRCm39) I1087T probably damaging Het
Sectm1b A G 11: 120,945,768 (GRCm39) I191T possibly damaging Het
Septin4 A G 11: 87,458,061 (GRCm39) H145R possibly damaging Het
Setd1b T C 5: 123,285,676 (GRCm39) S241P unknown Het
Slco1a8 T C 6: 141,949,149 (GRCm39) M76V possibly damaging Het
Srpk2 T C 5: 23,729,148 (GRCm39) K497R probably benign Het
Sspo T C 6: 48,467,940 (GRCm39) S4296P probably damaging Het
Syne4 T C 7: 30,016,308 (GRCm39) V168A probably benign Het
Tank T C 2: 61,480,256 (GRCm39) F264S probably damaging Het
Ticrr T C 7: 79,344,955 (GRCm39) S1607P probably damaging Het
Trim30a A G 7: 104,060,405 (GRCm39) V457A probably damaging Het
Trim43b T A 9: 88,967,624 (GRCm39) K336N probably damaging Het
Trim47 T C 11: 115,996,963 (GRCm39) Q598R probably damaging Het
Tspan12 T C 6: 21,851,022 (GRCm39) N18S probably damaging Het
Ubap2 A G 4: 41,221,607 (GRCm39) S231P probably benign Het
Vit A G 17: 78,930,175 (GRCm39) D380G probably damaging Het
Vmn2r2 T C 3: 64,041,942 (GRCm39) N258D possibly damaging Het
Vmn2r52 C T 7: 9,907,333 (GRCm39) C131Y possibly damaging Het
Zfp58 A T 13: 67,639,307 (GRCm39) F395I probably damaging Het
Zfp940 C A 7: 29,544,435 (GRCm39) G491C probably damaging Het
Other mutations in Prg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Prg4 APN 1 150,327,671 (GRCm39) missense probably damaging 0.99
IGL02033:Prg4 APN 1 150,331,619 (GRCm39) intron probably benign
IGL02154:Prg4 APN 1 150,330,613 (GRCm39) intron probably benign
IGL03111:Prg4 APN 1 150,327,653 (GRCm39) missense probably benign 0.06
IGL03177:Prg4 APN 1 150,331,354 (GRCm39) intron probably benign
IGL03260:Prg4 APN 1 150,331,378 (GRCm39) intron probably benign
IGL03281:Prg4 APN 1 150,325,839 (GRCm39) splice site probably benign
R0046:Prg4 UTSW 1 150,331,837 (GRCm39) missense possibly damaging 0.53
R0046:Prg4 UTSW 1 150,331,837 (GRCm39) missense possibly damaging 0.53
R0196:Prg4 UTSW 1 150,330,243 (GRCm39) intron probably benign
R0233:Prg4 UTSW 1 150,329,298 (GRCm39) splice site probably benign
R0255:Prg4 UTSW 1 150,331,558 (GRCm39) intron probably benign
R0616:Prg4 UTSW 1 150,336,462 (GRCm39) missense probably damaging 1.00
R1016:Prg4 UTSW 1 150,330,442 (GRCm39) intron probably benign
R1826:Prg4 UTSW 1 150,327,760 (GRCm39) missense probably benign 0.09
R1863:Prg4 UTSW 1 150,336,420 (GRCm39) missense probably damaging 0.99
R1922:Prg4 UTSW 1 150,325,750 (GRCm39) nonsense probably null
R1940:Prg4 UTSW 1 150,331,774 (GRCm39) missense possibly damaging 0.53
R3765:Prg4 UTSW 1 150,327,122 (GRCm39) missense probably damaging 0.97
R3855:Prg4 UTSW 1 150,327,751 (GRCm39) missense probably damaging 1.00
R3894:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R3895:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R3912:Prg4 UTSW 1 150,327,619 (GRCm39) missense probably damaging 1.00
R3935:Prg4 UTSW 1 150,333,908 (GRCm39) missense possibly damaging 0.68
R4050:Prg4 UTSW 1 150,330,510 (GRCm39) intron probably benign
R4475:Prg4 UTSW 1 150,330,610 (GRCm39) intron probably benign
R4794:Prg4 UTSW 1 150,330,297 (GRCm39) intron probably benign
R4910:Prg4 UTSW 1 150,331,574 (GRCm39) intron probably benign
R4911:Prg4 UTSW 1 150,331,574 (GRCm39) intron probably benign
R4993:Prg4 UTSW 1 150,336,432 (GRCm39) missense probably damaging 1.00
R5378:Prg4 UTSW 1 150,330,977 (GRCm39) intron probably benign
R5381:Prg4 UTSW 1 150,330,204 (GRCm39) intron probably benign
R5452:Prg4 UTSW 1 150,331,519 (GRCm39) intron probably benign
R5870:Prg4 UTSW 1 150,331,300 (GRCm39) nonsense probably null
R5888:Prg4 UTSW 1 150,328,101 (GRCm39) missense probably damaging 1.00
R5929:Prg4 UTSW 1 150,329,880 (GRCm39) missense probably benign 0.01
R6058:Prg4 UTSW 1 150,327,197 (GRCm39) missense probably damaging 0.99
R6059:Prg4 UTSW 1 150,325,748 (GRCm39) missense possibly damaging 0.67
R6232:Prg4 UTSW 1 150,331,567 (GRCm39) intron probably benign
R6272:Prg4 UTSW 1 150,330,517 (GRCm39) intron probably benign
R6459:Prg4 UTSW 1 150,330,052 (GRCm39) intron probably benign
R6659:Prg4 UTSW 1 150,336,432 (GRCm39) missense probably damaging 1.00
R6663:Prg4 UTSW 1 150,330,852 (GRCm39) intron probably benign
R6882:Prg4 UTSW 1 150,329,246 (GRCm39) missense probably damaging 1.00
R6970:Prg4 UTSW 1 150,331,657 (GRCm39) intron probably benign
R7078:Prg4 UTSW 1 150,334,014 (GRCm39) missense possibly damaging 0.91
R7102:Prg4 UTSW 1 150,328,005 (GRCm39) missense probably damaging 1.00
R7264:Prg4 UTSW 1 150,329,818 (GRCm39) missense not run
R7487:Prg4 UTSW 1 150,331,656 (GRCm39) missense unknown
R7531:Prg4 UTSW 1 150,330,786 (GRCm39) missense unknown
R7651:Prg4 UTSW 1 150,330,696 (GRCm39) missense unknown
R7701:Prg4 UTSW 1 150,333,293 (GRCm39) missense possibly damaging 0.53
R8072:Prg4 UTSW 1 150,331,774 (GRCm39) missense possibly damaging 0.53
R8168:Prg4 UTSW 1 150,331,601 (GRCm39) missense unknown
R8248:Prg4 UTSW 1 150,330,877 (GRCm39) missense unknown
R8436:Prg4 UTSW 1 150,331,318 (GRCm39) missense unknown
R8460:Prg4 UTSW 1 150,331,692 (GRCm39) missense possibly damaging 0.83
R8514:Prg4 UTSW 1 150,330,396 (GRCm39) missense unknown
R8904:Prg4 UTSW 1 150,331,810 (GRCm39) missense possibly damaging 0.83
R9072:Prg4 UTSW 1 150,331,288 (GRCm39) missense unknown
R9073:Prg4 UTSW 1 150,331,288 (GRCm39) missense unknown
R9274:Prg4 UTSW 1 150,331,924 (GRCm39) missense possibly damaging 0.53
R9337:Prg4 UTSW 1 150,327,116 (GRCm39) missense probably damaging 1.00
R9488:Prg4 UTSW 1 150,327,024 (GRCm39) missense probably benign
R9613:Prg4 UTSW 1 150,331,660 (GRCm39) missense unknown
R9670:Prg4 UTSW 1 150,326,618 (GRCm39) missense probably benign 0.01
X0024:Prg4 UTSW 1 150,330,243 (GRCm39) intron probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGGATCTTGGTGCTTCTAG -3'
(R):5'- GTCAGCTGTCAGATGAGAAATGC -3'

Sequencing Primer
(F):5'- GAGGACGCTTTCTTTCATTTGTC -3'
(R):5'- CTGTCAGATGAGAAATGCTACAAG -3'
Posted On 2014-06-23