Incidental Mutation 'R1862:Hdc'
ID 203997
Institutional Source Beutler Lab
Gene Symbol Hdc
Ensembl Gene ENSMUSG00000027360
Gene Name histidine decarboxylase
Synonyms Hdc-s, Hdc-a, L-histidine decarboxylase, Hdc-e, Hdc-c
MMRRC Submission 039885-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.834) question?
Stock # R1862 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 126435587-126461219 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 126439853 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 367 (I367F)
Ref Sequence ENSEMBL: ENSMUSP00000028838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028838]
AlphaFold P23738
Predicted Effect probably benign
Transcript: ENSMUST00000028838
AA Change: I367F

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028838
Gene: ENSMUSG00000027360
AA Change: I367F

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Pyridoxal_deC 43 421 2.2e-173 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138752
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group II decarboxylase family and forms a homodimer that converts L-histidine to histamine in a pyridoxal phosphate dependent manner. Histamine regulates several physiologic processes, including neurotransmission, gastric acid secretion,inflamation, and smooth muscle tone.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mast cells, altered anxiety-related and nociceptive behavior, altered cognitive function, increased weight gain, visceral adiposity, increased amount of brown adipose tissue, impaired glucose tolerance, hyperinsulinemia, and hyperleptinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 (GRCm38) E565D probably benign Het
Adam30 A T 3: 98,069,429 (GRCm39) K421* probably null Het
Atp6v1b1 A G 6: 83,726,834 (GRCm39) probably null Het
Cacna1a A T 8: 85,142,559 (GRCm39) I96F possibly damaging Het
Card10 G A 15: 78,664,714 (GRCm39) R747W probably damaging Het
Cdh8 T A 8: 99,917,026 (GRCm39) D363V probably damaging Het
Cecr2 T C 6: 120,734,902 (GRCm39) Y685H probably damaging Het
Cibar1 C T 4: 12,155,717 (GRCm39) V306I possibly damaging Het
Cmklr1 T C 5: 113,752,468 (GRCm39) T178A probably damaging Het
Col16a1 G A 4: 129,986,575 (GRCm39) probably null Het
Col4a1 C T 8: 11,276,439 (GRCm39) probably benign Het
Coro2a T A 4: 46,548,797 (GRCm39) I166F possibly damaging Het
Cry2 T C 2: 92,254,911 (GRCm39) H148R probably damaging Het
Crygd T C 1: 65,101,133 (GRCm39) Y154C probably benign Het
Cubn T C 2: 13,313,372 (GRCm39) Y3066C probably damaging Het
Defb15 C T 8: 22,420,002 (GRCm39) E42K possibly damaging Het
Dnah12 A G 14: 26,418,553 (GRCm39) D147G probably benign Het
Dnah12 A T 14: 26,430,412 (GRCm39) Y340F probably benign Het
Dot1l G T 10: 80,619,373 (GRCm39) R193L probably damaging Het
Dusp29 A G 14: 21,736,757 (GRCm39) V115A probably benign Het
Esd A C 14: 74,979,514 (GRCm39) Y119S probably damaging Het
Esp36 A G 17: 38,730,330 (GRCm39) probably benign Het
Etfbkmt T A 6: 149,045,649 (GRCm39) M1K probably null Het
Exph5 A G 9: 53,287,548 (GRCm39) H1543R probably benign Het
Fbxo16 A G 14: 65,508,252 (GRCm39) T23A probably damaging Het
Gorasp2 C A 2: 70,509,808 (GRCm39) H136Q probably damaging Het
Hmcn1 C T 1: 150,514,651 (GRCm39) V3574M probably benign Het
Ilvbl A G 10: 78,419,958 (GRCm39) D592G probably benign Het
Inmt G A 6: 55,151,868 (GRCm39) A34V probably damaging Het
Ints9 A C 14: 65,263,862 (GRCm39) H378P probably benign Het
Kcnh7 T A 2: 62,618,098 (GRCm39) I464L possibly damaging Het
Kcnt2 T A 1: 140,353,068 (GRCm39) V259D probably damaging Het
Lipo3 A G 19: 33,762,092 (GRCm39) F135S probably damaging Het
Lrba T C 3: 86,680,510 (GRCm39) probably null Het
Mapk1 T A 16: 16,844,293 (GRCm39) S22T probably benign Het
Mbd3l2 T C 9: 18,356,217 (GRCm39) S181P possibly damaging Het
Mgat5 C T 1: 127,387,706 (GRCm39) P554L probably damaging Het
Mki67 T C 7: 135,301,090 (GRCm39) T1315A probably benign Het
Mprip C T 11: 59,649,047 (GRCm39) T917M possibly damaging Het
Mroh3 T A 1: 136,113,726 (GRCm39) I688F probably benign Het
Myo1d A T 11: 80,553,874 (GRCm39) Y536N probably damaging Het
Neb C T 2: 52,052,199 (GRCm39) probably null Het
Noc2l A G 4: 156,322,165 (GRCm39) R161G probably benign Het
Nup54 T A 5: 92,567,426 (GRCm39) I375L possibly damaging Het
Nup93 T C 8: 95,032,730 (GRCm39) F539L probably damaging Het
Or10x1 T A 1: 174,197,018 (GRCm39) H178Q probably damaging Het
Or2n1e A G 17: 38,586,235 (GRCm39) E191G probably damaging Het
Or5p57 A C 7: 107,665,932 (GRCm39) Y24* probably null Het
Or8b12 T A 9: 37,658,264 (GRCm39) M278K probably benign Het
Panx1 A T 9: 14,918,724 (GRCm39) D378E probably damaging Het
Papss1 T A 3: 131,288,945 (GRCm39) V170D possibly damaging Het
Pcnx1 T C 12: 81,965,506 (GRCm39) S558P probably damaging Het
Pde3a G T 6: 141,433,239 (GRCm39) A757S probably damaging Het
Pde3a T A 6: 141,196,079 (GRCm39) I255N probably damaging Het
Pdzph1 A G 17: 59,229,578 (GRCm39) Y1027H probably damaging Het
Pkhd1 G T 1: 20,621,244 (GRCm39) R805S probably benign Het
Polr1a G A 6: 71,886,187 (GRCm39) G14D probably damaging Het
Prg4 T A 1: 150,336,420 (GRCm39) D60V probably damaging Het
Ptgr3 T C 18: 84,113,443 (GRCm39) V373A possibly damaging Het
Ptprc T C 1: 138,039,965 (GRCm39) S311G probably benign Het
Rapgefl1 G A 11: 98,733,035 (GRCm39) R205K probably benign Het
Rcan2 A T 17: 44,347,980 (GRCm39) probably null Het
Rock1 A G 18: 10,079,207 (GRCm39) I1087T probably damaging Het
Sectm1b A G 11: 120,945,768 (GRCm39) I191T possibly damaging Het
Septin4 A G 11: 87,458,061 (GRCm39) H145R possibly damaging Het
Setd1b T C 5: 123,285,676 (GRCm39) S241P unknown Het
Slco1a8 T C 6: 141,949,149 (GRCm39) M76V possibly damaging Het
Srpk2 T C 5: 23,729,148 (GRCm39) K497R probably benign Het
Sspo T C 6: 48,467,940 (GRCm39) S4296P probably damaging Het
Syne4 T C 7: 30,016,308 (GRCm39) V168A probably benign Het
Tank T C 2: 61,480,256 (GRCm39) F264S probably damaging Het
Ticrr T C 7: 79,344,955 (GRCm39) S1607P probably damaging Het
Trim30a A G 7: 104,060,405 (GRCm39) V457A probably damaging Het
Trim43b T A 9: 88,967,624 (GRCm39) K336N probably damaging Het
Trim47 T C 11: 115,996,963 (GRCm39) Q598R probably damaging Het
Tspan12 T C 6: 21,851,022 (GRCm39) N18S probably damaging Het
Ubap2 A G 4: 41,221,607 (GRCm39) S231P probably benign Het
Vit A G 17: 78,930,175 (GRCm39) D380G probably damaging Het
Vmn2r2 T C 3: 64,041,942 (GRCm39) N258D possibly damaging Het
Vmn2r52 C T 7: 9,907,333 (GRCm39) C131Y possibly damaging Het
Zfp58 A T 13: 67,639,307 (GRCm39) F395I probably damaging Het
Zfp940 C A 7: 29,544,435 (GRCm39) G491C probably damaging Het
Other mutations in Hdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Hdc APN 2 126,443,792 (GRCm39) missense probably benign 0.00
IGL01024:Hdc APN 2 126,445,766 (GRCm39) missense probably benign 0.32
IGL01393:Hdc APN 2 126,436,581 (GRCm39) missense probably benign 0.28
IGL01802:Hdc APN 2 126,445,814 (GRCm39) missense probably benign 0.04
IGL01958:Hdc APN 2 126,436,452 (GRCm39) missense possibly damaging 0.87
IGL02193:Hdc APN 2 126,443,700 (GRCm39) splice site probably benign
IGL02494:Hdc APN 2 126,436,041 (GRCm39) missense probably benign
IGL02696:Hdc APN 2 126,436,220 (GRCm39) missense probably damaging 1.00
IGL02874:Hdc APN 2 126,443,596 (GRCm39) missense probably benign 0.21
R0453:Hdc UTSW 2 126,436,871 (GRCm39) splice site probably benign
R0528:Hdc UTSW 2 126,458,152 (GRCm39) missense probably benign 0.00
R1337:Hdc UTSW 2 126,458,196 (GRCm39) missense probably benign
R1938:Hdc UTSW 2 126,448,317 (GRCm39) missense possibly damaging 0.86
R1994:Hdc UTSW 2 126,458,107 (GRCm39) missense probably damaging 1.00
R2230:Hdc UTSW 2 126,435,938 (GRCm39) missense possibly damaging 0.65
R2257:Hdc UTSW 2 126,458,000 (GRCm39) splice site probably null
R2921:Hdc UTSW 2 126,435,910 (GRCm39) missense probably damaging 1.00
R2923:Hdc UTSW 2 126,435,910 (GRCm39) missense probably damaging 1.00
R3620:Hdc UTSW 2 126,458,187 (GRCm39) missense possibly damaging 0.86
R3621:Hdc UTSW 2 126,458,187 (GRCm39) missense possibly damaging 0.86
R3914:Hdc UTSW 2 126,444,926 (GRCm39) missense probably damaging 1.00
R4076:Hdc UTSW 2 126,458,181 (GRCm39) missense possibly damaging 0.92
R4114:Hdc UTSW 2 126,443,738 (GRCm39) missense probably benign 0.16
R4213:Hdc UTSW 2 126,439,786 (GRCm39) splice site probably null
R4827:Hdc UTSW 2 126,436,233 (GRCm39) missense probably benign
R4889:Hdc UTSW 2 126,436,053 (GRCm39) missense probably benign 0.00
R5013:Hdc UTSW 2 126,446,220 (GRCm39) missense probably benign 0.33
R5593:Hdc UTSW 2 126,460,504 (GRCm39) utr 5 prime probably benign
R5604:Hdc UTSW 2 126,436,583 (GRCm39) missense probably benign
R5637:Hdc UTSW 2 126,458,109 (GRCm39) missense probably benign 0.02
R6211:Hdc UTSW 2 126,435,897 (GRCm39) missense probably damaging 0.98
R6312:Hdc UTSW 2 126,449,326 (GRCm39) missense possibly damaging 0.65
R7730:Hdc UTSW 2 126,436,002 (GRCm39) missense possibly damaging 0.51
R7889:Hdc UTSW 2 126,458,130 (GRCm39) missense probably damaging 1.00
R8328:Hdc UTSW 2 126,443,803 (GRCm39) missense probably damaging 1.00
R8482:Hdc UTSW 2 126,436,125 (GRCm39) missense probably benign
R8517:Hdc UTSW 2 126,439,890 (GRCm39) critical splice acceptor site probably null
R9136:Hdc UTSW 2 126,439,786 (GRCm39) splice site probably null
R9139:Hdc UTSW 2 126,439,837 (GRCm39) missense probably damaging 1.00
R9208:Hdc UTSW 2 126,436,600 (GRCm39) missense probably benign 0.32
R9515:Hdc UTSW 2 126,458,149 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTACATGGAGATCAGCGCAC -3'
(R):5'- ACAGCTTTGGGAGTCATGG -3'

Sequencing Primer
(F):5'- TGGAGATCAGCGCACCTCTAC -3'
(R):5'- TGGTGACACCAGGGAAATCCC -3'
Posted On 2014-06-23