Incidental Mutation 'R1862:Hdc'
ID 203997
Institutional Source Beutler Lab
Gene Symbol Hdc
Ensembl Gene ENSMUSG00000027360
Gene Name histidine decarboxylase
Synonyms Hdc-s, Hdc-a, Hdc-c, Hdc-e, L-histidine decarboxylase
MMRRC Submission 039885-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock # R1862 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 126593667-126619299 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 126597933 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 367 (I367F)
Ref Sequence ENSEMBL: ENSMUSP00000028838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028838]
AlphaFold P23738
Predicted Effect probably benign
Transcript: ENSMUST00000028838
AA Change: I367F

PolyPhen 2 Score 0.360 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028838
Gene: ENSMUSG00000027360
AA Change: I367F

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:Pyridoxal_deC 43 421 2.2e-173 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138752
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group II decarboxylase family and forms a homodimer that converts L-histidine to histamine in a pyridoxal phosphate dependent manner. Histamine regulates several physiologic processes, including neurotransmission, gastric acid secretion,inflamation, and smooth muscle tone.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal mast cells, altered anxiety-related and nociceptive behavior, altered cognitive function, increased weight gain, visceral adiposity, increased amount of brown adipose tissue, impaired glucose tolerance, hyperinsulinemia, and hyperleptinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 E565D probably benign Het
Adam30 A T 3: 98,162,113 K421* probably null Het
Atp6v1b1 A G 6: 83,749,852 probably null Het
Cacna1a A T 8: 84,415,930 I96F possibly damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cdh8 T A 8: 99,190,394 D363V probably damaging Het
Cecr2 T C 6: 120,757,941 Y685H probably damaging Het
Cmklr1 T C 5: 113,614,407 T178A probably damaging Het
Col16a1 G A 4: 130,092,782 probably null Het
Col4a1 C T 8: 11,226,439 probably benign Het
Coro2a T A 4: 46,548,797 I166F possibly damaging Het
Cry2 T C 2: 92,424,566 H148R probably damaging Het
Crygd T C 1: 65,061,974 Y154C probably benign Het
Cubn T C 2: 13,308,561 Y3066C probably damaging Het
Defb15 C T 8: 21,929,986 E42K possibly damaging Het
Dnah12 A G 14: 26,697,398 D147G probably benign Het
Dnah12 A T 14: 26,709,257 Y340F probably benign Het
Dot1l G T 10: 80,783,539 R193L probably damaging Het
Dupd1 A G 14: 21,686,689 V115A probably benign Het
Esd A C 14: 74,742,074 Y119S probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Etfbkmt T A 6: 149,144,151 M1K probably null Het
Exph5 A G 9: 53,376,248 H1543R probably benign Het
Fam92a C T 4: 12,155,717 V306I possibly damaging Het
Fbxo16 A G 14: 65,270,803 T23A probably damaging Het
Gm11492 A G 11: 87,567,235 H145R possibly damaging Het
Gm6614 T C 6: 142,003,423 M76V possibly damaging Het
Gorasp2 C A 2: 70,679,464 H136Q probably damaging Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ilvbl A G 10: 78,584,124 D592G probably benign Het
Inmt G A 6: 55,174,883 A34V probably damaging Het
Ints9 A C 14: 65,026,413 H378P probably benign Het
Kcnh7 T A 2: 62,787,754 I464L possibly damaging Het
Kcnt2 T A 1: 140,425,330 V259D probably damaging Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrba T C 3: 86,773,203 probably null Het
Mapk1 T A 16: 17,026,429 S22T probably benign Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mgat5 C T 1: 127,459,969 P554L probably damaging Het
Mki67 T C 7: 135,699,361 T1315A probably benign Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Mroh3 T A 1: 136,185,988 I688F probably benign Het
Myo1d A T 11: 80,663,048 Y536N probably damaging Het
Neb C T 2: 52,162,187 probably null Het
Noc2l A G 4: 156,237,708 R161G probably benign Het
Nup54 T A 5: 92,419,567 I375L possibly damaging Het
Nup93 T C 8: 94,306,102 F539L probably damaging Het
Olfr138 A G 17: 38,275,344 E191G probably damaging Het
Olfr417 T A 1: 174,369,452 H178Q probably damaging Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr874 T A 9: 37,746,968 M278K probably benign Het
Panx1 A T 9: 15,007,428 D378E probably damaging Het
Papss1 T A 3: 131,583,184 V170D possibly damaging Het
Pcnx T C 12: 81,918,732 S558P probably damaging Het
Pde3a T A 6: 141,250,353 I255N probably damaging Het
Pde3a G T 6: 141,487,513 A757S probably damaging Het
Pdzph1 A G 17: 58,922,583 Y1027H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Polr1a G A 6: 71,909,203 G14D probably damaging Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Ptprc T C 1: 138,112,227 S311G probably benign Het
Rapgefl1 G A 11: 98,842,209 R205K probably benign Het
Rcan2 A T 17: 44,037,089 probably null Het
Rock1 A G 18: 10,079,207 I1087T probably damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Setd1b T C 5: 123,147,613 S241P unknown Het
Srpk2 T C 5: 23,524,150 K497R probably benign Het
Sspo T C 6: 48,491,006 S4296P probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tank T C 2: 61,649,912 F264S probably damaging Het
Ticrr T C 7: 79,695,207 S1607P probably damaging Het
Trim30a A G 7: 104,411,198 V457A probably damaging Het
Trim43b T A 9: 89,085,571 K336N probably damaging Het
Trim47 T C 11: 116,106,137 Q598R probably damaging Het
Tspan12 T C 6: 21,851,023 N18S probably damaging Het
Ubap2 A G 4: 41,221,607 S231P probably benign Het
Vit A G 17: 78,622,746 D380G probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Vmn2r52 C T 7: 10,173,406 C131Y possibly damaging Het
Zadh2 T C 18: 84,095,318 V373A possibly damaging Het
Zfp58 A T 13: 67,491,188 F395I probably damaging Het
Zfp940 C A 7: 29,845,010 G491C probably damaging Het
Other mutations in Hdc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Hdc APN 2 126601872 missense probably benign 0.00
IGL01024:Hdc APN 2 126603846 missense probably benign 0.32
IGL01393:Hdc APN 2 126594661 missense probably benign 0.28
IGL01802:Hdc APN 2 126603894 missense probably benign 0.04
IGL01958:Hdc APN 2 126594532 missense possibly damaging 0.87
IGL02193:Hdc APN 2 126601780 splice site probably benign
IGL02494:Hdc APN 2 126594121 missense probably benign
IGL02696:Hdc APN 2 126594300 missense probably damaging 1.00
IGL02874:Hdc APN 2 126601676 missense probably benign 0.21
R0453:Hdc UTSW 2 126594951 splice site probably benign
R0528:Hdc UTSW 2 126616232 missense probably benign 0.00
R1337:Hdc UTSW 2 126616276 missense probably benign
R1938:Hdc UTSW 2 126606397 missense possibly damaging 0.86
R1994:Hdc UTSW 2 126616187 missense probably damaging 1.00
R2230:Hdc UTSW 2 126594018 missense possibly damaging 0.65
R2257:Hdc UTSW 2 126616080 splice site probably null
R2921:Hdc UTSW 2 126593990 missense probably damaging 1.00
R2923:Hdc UTSW 2 126593990 missense probably damaging 1.00
R3620:Hdc UTSW 2 126616267 missense possibly damaging 0.86
R3621:Hdc UTSW 2 126616267 missense possibly damaging 0.86
R3914:Hdc UTSW 2 126603006 missense probably damaging 1.00
R4076:Hdc UTSW 2 126616261 missense possibly damaging 0.92
R4114:Hdc UTSW 2 126601818 missense probably benign 0.16
R4213:Hdc UTSW 2 126597866 splice site probably null
R4827:Hdc UTSW 2 126594313 missense probably benign
R4889:Hdc UTSW 2 126594133 missense probably benign 0.00
R5013:Hdc UTSW 2 126604300 missense probably benign 0.33
R5593:Hdc UTSW 2 126618584 utr 5 prime probably benign
R5604:Hdc UTSW 2 126594663 missense probably benign
R5637:Hdc UTSW 2 126616189 missense probably benign 0.02
R6211:Hdc UTSW 2 126593977 missense probably damaging 0.98
R6312:Hdc UTSW 2 126607406 missense possibly damaging 0.65
R7730:Hdc UTSW 2 126594082 missense possibly damaging 0.51
R7889:Hdc UTSW 2 126616210 missense probably damaging 1.00
R8328:Hdc UTSW 2 126601883 missense probably damaging 1.00
R8482:Hdc UTSW 2 126594205 missense probably benign
R8517:Hdc UTSW 2 126597970 critical splice acceptor site probably null
R9136:Hdc UTSW 2 126597866 splice site probably null
R9139:Hdc UTSW 2 126597917 missense probably damaging 1.00
R9208:Hdc UTSW 2 126594680 missense probably benign 0.32
R9515:Hdc UTSW 2 126616229 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTACATGGAGATCAGCGCAC -3'
(R):5'- ACAGCTTTGGGAGTCATGG -3'

Sequencing Primer
(F):5'- TGGAGATCAGCGCACCTCTAC -3'
(R):5'- TGGTGACACCAGGGAAATCCC -3'
Posted On 2014-06-23