Incidental Mutation 'R1862:Papss1'
ID204002
Institutional Source Beutler Lab
Gene Symbol Papss1
Ensembl Gene ENSMUSG00000028032
Gene Name3'-phosphoadenosine 5'-phosphosulfate synthase 1
SynonymsAsapk, SK1
MMRRC Submission 039885-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.582) question?
Stock #R1862 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location131564768-131643671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131583184 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 170 (V170D)
Ref Sequence ENSEMBL: ENSMUSP00000029666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029666] [ENSMUST00000196408] [ENSMUST00000196638] [ENSMUST00000197402] [ENSMUST00000199878] [ENSMUST00000200527]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029666
AA Change: V170D

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029666
Gene: ENSMUSG00000028032
AA Change: V170D

DomainStartEndE-ValueType
Pfam:APS_kinase 51 209 5.6e-78 PFAM
Pfam:AAA_17 54 184 1.7e-7 PFAM
Pfam:AAA_33 55 182 4.4e-9 PFAM
Pfam:PUA_2 225 386 3.3e-51 PFAM
Pfam:ATP-sulfurylase 394 617 7.8e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196408
Predicted Effect probably benign
Transcript: ENSMUST00000196638
Predicted Effect probably benign
Transcript: ENSMUST00000197402
Predicted Effect possibly damaging
Transcript: ENSMUST00000199878
AA Change: V149D

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142533
Gene: ENSMUSG00000028032
AA Change: V149D

DomainStartEndE-ValueType
Pfam:APS_kinase 30 188 4.5e-75 PFAM
Pfam:AAA_33 33 169 8.5e-10 PFAM
Pfam:AAA_17 33 180 6.1e-6 PFAM
Pfam:PUA_2 204 365 2.7e-47 PFAM
Pfam:ATP-sulfurylase 372 597 6.6e-70 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200527
AA Change: V149D

PolyPhen 2 Score 0.739 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142616
Gene: ENSMUSG00000028032
AA Change: V149D

DomainStartEndE-ValueType
Pfam:APS_kinase 30 188 4.5e-75 PFAM
Pfam:AAA_33 33 169 8.5e-10 PFAM
Pfam:AAA_17 33 180 6.1e-6 PFAM
Pfam:PUA_2 204 365 2.7e-47 PFAM
Pfam:ATP-sulfurylase 372 597 6.6e-70 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Three-prime-phosphoadenosine 5-prime-phosphosulfate (PAPS) is the sulfate donor cosubstrate for all sulfotransferase (SULT) enzymes (Xu et al., 2000 [PubMed 10679223]). SULTs catalyze the sulfate conjugation of many endogenous and exogenous compounds, including drugs and other xenobiotics. In humans, PAPS is synthesized from adenosine 5-prime triphosphate (ATP) and inorganic sulfate by 2 isoforms, PAPSS1 and PAPSS2 (MIM 603005).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 E565D probably benign Het
Adam30 A T 3: 98,162,113 K421* probably null Het
Atp6v1b1 A G 6: 83,749,852 probably null Het
Cacna1a A T 8: 84,415,930 I96F possibly damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cdh8 T A 8: 99,190,394 D363V probably damaging Het
Cecr2 T C 6: 120,757,941 Y685H probably damaging Het
Cmklr1 T C 5: 113,614,407 T178A probably damaging Het
Col16a1 G A 4: 130,092,782 probably null Het
Col4a1 C T 8: 11,226,439 probably benign Het
Coro2a T A 4: 46,548,797 I166F possibly damaging Het
Cry2 T C 2: 92,424,566 H148R probably damaging Het
Crygd T C 1: 65,061,974 Y154C probably benign Het
Cubn T C 2: 13,308,561 Y3066C probably damaging Het
Defb15 C T 8: 21,929,986 E42K possibly damaging Het
Dnah12 A G 14: 26,697,398 D147G probably benign Het
Dnah12 A T 14: 26,709,257 Y340F probably benign Het
Dot1l G T 10: 80,783,539 R193L probably damaging Het
Dupd1 A G 14: 21,686,689 V115A probably benign Het
Esd A C 14: 74,742,074 Y119S probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Etfbkmt T A 6: 149,144,151 M1K probably null Het
Exph5 A G 9: 53,376,248 H1543R probably benign Het
Fam92a C T 4: 12,155,717 V306I possibly damaging Het
Fbxo16 A G 14: 65,270,803 T23A probably damaging Het
Gm11492 A G 11: 87,567,235 H145R possibly damaging Het
Gm6614 T C 6: 142,003,423 M76V possibly damaging Het
Gorasp2 C A 2: 70,679,464 H136Q probably damaging Het
Hdc T A 2: 126,597,933 I367F probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ilvbl A G 10: 78,584,124 D592G probably benign Het
Inmt G A 6: 55,174,883 A34V probably damaging Het
Ints9 A C 14: 65,026,413 H378P probably benign Het
Kcnh7 T A 2: 62,787,754 I464L possibly damaging Het
Kcnt2 T A 1: 140,425,330 V259D probably damaging Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrba T C 3: 86,773,203 probably null Het
Mapk1 T A 16: 17,026,429 S22T probably benign Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mgat5 C T 1: 127,459,969 P554L probably damaging Het
Mki67 T C 7: 135,699,361 T1315A probably benign Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Mroh3 T A 1: 136,185,988 I688F probably benign Het
Myo1d A T 11: 80,663,048 Y536N probably damaging Het
Neb C T 2: 52,162,187 probably null Het
Noc2l A G 4: 156,237,708 R161G probably benign Het
Nup54 T A 5: 92,419,567 I375L possibly damaging Het
Nup93 T C 8: 94,306,102 F539L probably damaging Het
Olfr138 A G 17: 38,275,344 E191G probably damaging Het
Olfr417 T A 1: 174,369,452 H178Q probably damaging Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr874 T A 9: 37,746,968 M278K probably benign Het
Panx1 A T 9: 15,007,428 D378E probably damaging Het
Pcnx T C 12: 81,918,732 S558P probably damaging Het
Pde3a T A 6: 141,250,353 I255N probably damaging Het
Pde3a G T 6: 141,487,513 A757S probably damaging Het
Pdzph1 A G 17: 58,922,583 Y1027H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Polr1a G A 6: 71,909,203 G14D probably damaging Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Ptprc T C 1: 138,112,227 S311G probably benign Het
Rapgefl1 G A 11: 98,842,209 R205K probably benign Het
Rcan2 A T 17: 44,037,089 probably null Het
Rock1 A G 18: 10,079,207 I1087T probably damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Setd1b T C 5: 123,147,613 S241P unknown Het
Srpk2 T C 5: 23,524,150 K497R probably benign Het
Sspo T C 6: 48,491,006 S4296P probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tank T C 2: 61,649,912 F264S probably damaging Het
Ticrr T C 7: 79,695,207 S1607P probably damaging Het
Trim30a A G 7: 104,411,198 V457A probably damaging Het
Trim43b T A 9: 89,085,571 K336N probably damaging Het
Trim47 T C 11: 116,106,137 Q598R probably damaging Het
Tspan12 T C 6: 21,851,023 N18S probably damaging Het
Ubap2 A G 4: 41,221,607 S231P probably benign Het
Vit A G 17: 78,622,746 D380G probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Vmn2r52 C T 7: 10,173,406 C131Y possibly damaging Het
Zadh2 T C 18: 84,095,318 V373A possibly damaging Het
Zfp58 A T 13: 67,491,188 F395I probably damaging Het
Zfp940 C A 7: 29,845,010 G491C probably damaging Het
Other mutations in Papss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00955:Papss1 APN 3 131599949 missense probably benign 0.00
IGL01642:Papss1 APN 3 131583235 splice site probably benign
IGL02249:Papss1 APN 3 131602011 missense probably damaging 1.00
IGL02832:Papss1 APN 3 131582519 missense probably damaging 1.00
IGL03008:Papss1 APN 3 131585099 missense possibly damaging 0.55
IGL03180:Papss1 APN 3 131607382 missense probably damaging 1.00
IGL03343:Papss1 APN 3 131583189 missense probably benign 0.27
IGL03384:Papss1 APN 3 131579352 missense probably damaging 0.96
R0549:Papss1 UTSW 3 131619213 missense possibly damaging 0.87
R0685:Papss1 UTSW 3 131583093 missense possibly damaging 0.61
R0800:Papss1 UTSW 3 131599854 splice site probably benign
R1225:Papss1 UTSW 3 131579301 splice site probably benign
R1458:Papss1 UTSW 3 131605854 missense probably damaging 1.00
R1718:Papss1 UTSW 3 131619185 missense probably damaging 1.00
R1728:Papss1 UTSW 3 131605967 missense probably benign 0.00
R1784:Papss1 UTSW 3 131605967 missense probably benign 0.00
R1937:Papss1 UTSW 3 131599871 missense probably benign 0.38
R2349:Papss1 UTSW 3 131599866 missense probably benign
R3859:Papss1 UTSW 3 131607335 missense probably benign 0.30
R4698:Papss1 UTSW 3 131607331 missense probably damaging 0.97
R4741:Papss1 UTSW 3 131619099 missense probably damaging 1.00
R5333:Papss1 UTSW 3 131643044 missense probably damaging 1.00
R5642:Papss1 UTSW 3 131631804 nonsense probably null
R6658:Papss1 UTSW 3 131605935 missense probably benign
R6932:Papss1 UTSW 3 131599971 missense probably damaging 1.00
R7051:Papss1 UTSW 3 131602050 missense probably damaging 1.00
R7199:Papss1 UTSW 3 131585138 missense probably benign 0.01
R7201:Papss1 UTSW 3 131599926 missense probably damaging 1.00
R7276:Papss1 UTSW 3 131619234 missense probably benign 0.11
Z1088:Papss1 UTSW 3 131642967 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CAGAGTCCCTTACATCCATCC -3'
(R):5'- CTCAACCAGCTCAGGTCATTTC -3'

Sequencing Primer
(F):5'- CTGATGTCAGGGCATCCGAC -3'
(R):5'- CAAGACTTATCAGTTCTGGGGAC -3'
Posted On2014-06-23