Incidental Mutation 'R1862:Ubap2'
ID204004
Institutional Source Beutler Lab
Gene Symbol Ubap2
Ensembl Gene ENSMUSG00000028433
Gene Nameubiquitin-associated protein 2
Synonyms1190005K07Rik
MMRRC Submission 039885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R1862 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location41194313-41275144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41221607 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 231 (S231P)
Ref Sequence ENSEMBL: ENSMUSP00000103703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000108068]
Predicted Effect probably benign
Transcript: ENSMUST00000030143
AA Change: S232P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433
AA Change: S232P

DomainStartEndE-ValueType
UBA 53 91 9.62e-8 SMART
low complexity region 115 127 N/A INTRINSIC
low complexity region 130 144 N/A INTRINSIC
low complexity region 166 185 N/A INTRINSIC
low complexity region 256 266 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
Pfam:DUF3697 512 544 1.5e-18 PFAM
low complexity region 583 618 N/A INTRINSIC
low complexity region 631 644 N/A INTRINSIC
low complexity region 696 722 N/A INTRINSIC
low complexity region 744 768 N/A INTRINSIC
low complexity region 787 800 N/A INTRINSIC
low complexity region 888 914 N/A INTRINSIC
low complexity region 1007 1024 N/A INTRINSIC
low complexity region 1057 1078 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
low complexity region 1101 1115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108068
AA Change: S231P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433
AA Change: S231P

DomainStartEndE-ValueType
UBA 52 90 9.62e-8 SMART
low complexity region 114 126 N/A INTRINSIC
low complexity region 129 143 N/A INTRINSIC
low complexity region 165 184 N/A INTRINSIC
low complexity region 255 265 N/A INTRINSIC
low complexity region 340 357 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
Pfam:DUF3697 511 543 1.2e-20 PFAM
low complexity region 582 617 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 695 721 N/A INTRINSIC
low complexity region 743 767 N/A INTRINSIC
low complexity region 786 799 N/A INTRINSIC
low complexity region 887 913 N/A INTRINSIC
low complexity region 1006 1023 N/A INTRINSIC
low complexity region 1056 1077 N/A INTRINSIC
low complexity region 1083 1097 N/A INTRINSIC
low complexity region 1100 1114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132499
Predicted Effect unknown
Transcript: ENSMUST00000134782
AA Change: S239P
SMART Domains Protein: ENSMUSP00000121724
Gene: ENSMUSG00000028433
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
UBA 61 99 9.62e-8 SMART
low complexity region 123 135 N/A INTRINSIC
low complexity region 138 152 N/A INTRINSIC
low complexity region 174 193 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 E565D probably benign Het
Adam30 A T 3: 98,162,113 K421* probably null Het
Atp6v1b1 A G 6: 83,749,852 probably null Het
Cacna1a A T 8: 84,415,930 I96F possibly damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cdh8 T A 8: 99,190,394 D363V probably damaging Het
Cecr2 T C 6: 120,757,941 Y685H probably damaging Het
Cmklr1 T C 5: 113,614,407 T178A probably damaging Het
Col16a1 G A 4: 130,092,782 probably null Het
Col4a1 C T 8: 11,226,439 probably benign Het
Coro2a T A 4: 46,548,797 I166F possibly damaging Het
Cry2 T C 2: 92,424,566 H148R probably damaging Het
Crygd T C 1: 65,061,974 Y154C probably benign Het
Cubn T C 2: 13,308,561 Y3066C probably damaging Het
Defb15 C T 8: 21,929,986 E42K possibly damaging Het
Dnah12 A G 14: 26,697,398 D147G probably benign Het
Dnah12 A T 14: 26,709,257 Y340F probably benign Het
Dot1l G T 10: 80,783,539 R193L probably damaging Het
Dupd1 A G 14: 21,686,689 V115A probably benign Het
Esd A C 14: 74,742,074 Y119S probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Etfbkmt T A 6: 149,144,151 M1K probably null Het
Exph5 A G 9: 53,376,248 H1543R probably benign Het
Fam92a C T 4: 12,155,717 V306I possibly damaging Het
Fbxo16 A G 14: 65,270,803 T23A probably damaging Het
Gm11492 A G 11: 87,567,235 H145R possibly damaging Het
Gm6614 T C 6: 142,003,423 M76V possibly damaging Het
Gorasp2 C A 2: 70,679,464 H136Q probably damaging Het
Hdc T A 2: 126,597,933 I367F probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ilvbl A G 10: 78,584,124 D592G probably benign Het
Inmt G A 6: 55,174,883 A34V probably damaging Het
Ints9 A C 14: 65,026,413 H378P probably benign Het
Kcnh7 T A 2: 62,787,754 I464L possibly damaging Het
Kcnt2 T A 1: 140,425,330 V259D probably damaging Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrba T C 3: 86,773,203 probably null Het
Mapk1 T A 16: 17,026,429 S22T probably benign Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mgat5 C T 1: 127,459,969 P554L probably damaging Het
Mki67 T C 7: 135,699,361 T1315A probably benign Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Mroh3 T A 1: 136,185,988 I688F probably benign Het
Myo1d A T 11: 80,663,048 Y536N probably damaging Het
Neb C T 2: 52,162,187 probably null Het
Noc2l A G 4: 156,237,708 R161G probably benign Het
Nup54 T A 5: 92,419,567 I375L possibly damaging Het
Nup93 T C 8: 94,306,102 F539L probably damaging Het
Olfr138 A G 17: 38,275,344 E191G probably damaging Het
Olfr417 T A 1: 174,369,452 H178Q probably damaging Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr874 T A 9: 37,746,968 M278K probably benign Het
Panx1 A T 9: 15,007,428 D378E probably damaging Het
Papss1 T A 3: 131,583,184 V170D possibly damaging Het
Pcnx T C 12: 81,918,732 S558P probably damaging Het
Pde3a T A 6: 141,250,353 I255N probably damaging Het
Pde3a G T 6: 141,487,513 A757S probably damaging Het
Pdzph1 A G 17: 58,922,583 Y1027H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Polr1a G A 6: 71,909,203 G14D probably damaging Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Ptprc T C 1: 138,112,227 S311G probably benign Het
Rapgefl1 G A 11: 98,842,209 R205K probably benign Het
Rcan2 A T 17: 44,037,089 probably null Het
Rock1 A G 18: 10,079,207 I1087T probably damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Setd1b T C 5: 123,147,613 S241P unknown Het
Srpk2 T C 5: 23,524,150 K497R probably benign Het
Sspo T C 6: 48,491,006 S4296P probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tank T C 2: 61,649,912 F264S probably damaging Het
Ticrr T C 7: 79,695,207 S1607P probably damaging Het
Trim30a A G 7: 104,411,198 V457A probably damaging Het
Trim43b T A 9: 89,085,571 K336N probably damaging Het
Trim47 T C 11: 116,106,137 Q598R probably damaging Het
Tspan12 T C 6: 21,851,023 N18S probably damaging Het
Vit A G 17: 78,622,746 D380G probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Vmn2r52 C T 7: 10,173,406 C131Y possibly damaging Het
Zadh2 T C 18: 84,095,318 V373A possibly damaging Het
Zfp58 A T 13: 67,491,188 F395I probably damaging Het
Zfp940 C A 7: 29,845,010 G491C probably damaging Het
Other mutations in Ubap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Ubap2 APN 4 41195328 splice site probably benign
IGL01109:Ubap2 APN 4 41195155 missense probably damaging 1.00
IGL01354:Ubap2 APN 4 41207005 missense probably damaging 1.00
IGL01563:Ubap2 APN 4 41195998 missense probably damaging 0.96
IGL01602:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01605:Ubap2 APN 4 41227237 missense probably damaging 1.00
IGL01688:Ubap2 APN 4 41226308 missense probably benign
IGL01733:Ubap2 APN 4 41195862 unclassified probably benign
IGL01896:Ubap2 APN 4 41202362 missense possibly damaging 0.85
IGL01942:Ubap2 APN 4 41251608 missense probably benign 0.00
IGL02095:Ubap2 APN 4 41229709 missense probably benign
R0608:Ubap2 UTSW 4 41218319 missense probably benign 0.10
R0938:Ubap2 UTSW 4 41202304 missense probably damaging 1.00
R1449:Ubap2 UTSW 4 41209351 critical splice donor site probably null
R1484:Ubap2 UTSW 4 41235593 missense probably damaging 1.00
R1548:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1549:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1604:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1607:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1739:Ubap2 UTSW 4 41206849 missense probably benign 0.00
R1772:Ubap2 UTSW 4 41202380 missense probably benign 0.02
R1869:Ubap2 UTSW 4 41233617 missense probably damaging 1.00
R1886:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R1887:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2063:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2064:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2065:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2066:Ubap2 UTSW 4 41199872 missense probably benign 0.12
R2095:Ubap2 UTSW 4 41206901 missense possibly damaging 0.68
R2214:Ubap2 UTSW 4 41199714 critical splice donor site probably null
R2215:Ubap2 UTSW 4 41196483 splice site probably null
R2318:Ubap2 UTSW 4 41251542 missense probably damaging 0.99
R3755:Ubap2 UTSW 4 41195482 missense probably damaging 1.00
R4620:Ubap2 UTSW 4 41233698 missense probably damaging 1.00
R4717:Ubap2 UTSW 4 41218333 missense possibly damaging 0.93
R4756:Ubap2 UTSW 4 41211771 missense probably damaging 1.00
R4942:Ubap2 UTSW 4 41245461 intron probably benign
R5344:Ubap2 UTSW 4 41251578 missense possibly damaging 0.46
R5763:Ubap2 UTSW 4 41195809 missense probably damaging 1.00
R5851:Ubap2 UTSW 4 41206268 nonsense probably null
R5951:Ubap2 UTSW 4 41205753 splice site probably null
R6178:Ubap2 UTSW 4 41206981 missense probably benign
R6489:Ubap2 UTSW 4 41203574 critical splice acceptor site probably null
R6520:Ubap2 UTSW 4 41195155 missense probably damaging 1.00
R6652:Ubap2 UTSW 4 41196743 missense possibly damaging 0.68
R6702:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227210 small insertion probably benign
R6736:Ubap2 UTSW 4 41227224 small insertion probably benign
R6860:Ubap2 UTSW 4 41233631 missense probably damaging 1.00
R7007:Ubap2 UTSW 4 41206221 missense probably damaging 0.97
R7048:Ubap2 UTSW 4 41196033 missense possibly damaging 0.49
R7121:Ubap2 UTSW 4 41205550 missense probably benign 0.00
R7371:Ubap2 UTSW 4 41195779 missense probably benign 0.16
R7378:Ubap2 UTSW 4 41235515 critical splice donor site probably null
R7695:Ubap2 UTSW 4 41211740 missense probably damaging 0.98
R7811:Ubap2 UTSW 4 41211710 missense probably benign 0.22
R7828:Ubap2 UTSW 4 41221615 missense probably benign 0.00
R7838:Ubap2 UTSW 4 41233655 missense probably damaging 1.00
R8016:Ubap2 UTSW 4 41195201 missense possibly damaging 0.91
X0061:Ubap2 UTSW 4 41196507 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTCAAACTCAAACCTAGGCC -3'
(R):5'- CCAATCCAGCGTAGTCAGAC -3'

Sequencing Primer
(F):5'- GCCTCAGGAAGTCTACGTGAAC -3'
(R):5'- CCAGCGTAGTCAGACATTTAATAC -3'
Posted On2014-06-23