Mutagenetix > Incidental Mutation

Incidental Mutation 'R1862:Ubap2'

204004

Institutional Source

Beutler Lab

Gene Symbol

Ubap2

Ensembl Gene

ENSMUSG00000028433

Gene Name

ubiquitin-associated protein 2

Synonyms

1190005K07Rik

MMRRC Submission

039885-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.177) question?

Stock #

R1862 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41194313-41275144 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41221607 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 231 (S231P)

Ref Sequence

ENSEMBL: ENSMUSP00000103703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030143] [ENSMUST00000108068]

AlphaFold

Q91VX2

Predicted Effect

probably benign
Transcript: ENSMUST00000030143
AA Change: S232P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000030143
Gene: ENSMUSG00000028433
AA Change: S232P

Domain	Start	End	E-Value	Type
UBA	53	91	9.62e-8	SMART
low complexity region	115	127	N/A	INTRINSIC
low complexity region	130	144	N/A	INTRINSIC
low complexity region	166	185	N/A	INTRINSIC
low complexity region	256	266	N/A	INTRINSIC
low complexity region	341	358	N/A	INTRINSIC
low complexity region	436	448	N/A	INTRINSIC
Pfam:DUF3697	512	544	1.5e-18	PFAM
low complexity region	583	618	N/A	INTRINSIC
low complexity region	631	644	N/A	INTRINSIC
low complexity region	696	722	N/A	INTRINSIC
low complexity region	744	768	N/A	INTRINSIC
low complexity region	787	800	N/A	INTRINSIC
low complexity region	888	914	N/A	INTRINSIC
low complexity region	1007	1024	N/A	INTRINSIC
low complexity region	1057	1078	N/A	INTRINSIC
low complexity region	1084	1098	N/A	INTRINSIC
low complexity region	1101	1115	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108068
AA Change: S231P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000103703
Gene: ENSMUSG00000028433
AA Change: S231P

Domain	Start	End	E-Value	Type
UBA	52	90	9.62e-8	SMART
low complexity region	114	126	N/A	INTRINSIC
low complexity region	129	143	N/A	INTRINSIC
low complexity region	165	184	N/A	INTRINSIC
low complexity region	255	265	N/A	INTRINSIC
low complexity region	340	357	N/A	INTRINSIC
low complexity region	435	447	N/A	INTRINSIC
Pfam:DUF3697	511	543	1.2e-20	PFAM
low complexity region	582	617	N/A	INTRINSIC
low complexity region	630	643	N/A	INTRINSIC
low complexity region	695	721	N/A	INTRINSIC
low complexity region	743	767	N/A	INTRINSIC
low complexity region	786	799	N/A	INTRINSIC
low complexity region	887	913	N/A	INTRINSIC
low complexity region	1006	1023	N/A	INTRINSIC
low complexity region	1056	1077	N/A	INTRINSIC
low complexity region	1083	1097	N/A	INTRINSIC
low complexity region	1100	1114	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132499

Predicted Effect

unknown
Transcript: ENSMUST00000134782
AA Change: S239P

SMART Domains

Protein: ENSMUSP00000121724
Gene: ENSMUSG00000028433
AA Change: S239P

Domain	Start	End	E-Value	Type
low complexity region	33	45	N/A	INTRINSIC
UBA	61	99	9.62e-8	SMART
low complexity region	123	135	N/A	INTRINSIC
low complexity region	138	152	N/A	INTRINSIC
low complexity region	174	193	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.9%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a UBA (ubiquitin associated) domain, which is characteristic of proteins that function in the ubiquitination pathway. This gene may show increased expression in the adrenal gland and lymphatic tissues. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	A	14: 8,241,416	E565D	probably benign	Het
Adam30	A	T	3: 98,162,113	K421*	probably null	Het
Atp6v1b1	A	G	6: 83,749,852		probably null	Het
Cacna1a	A	T	8: 84,415,930	I96F	possibly damaging	Het
Card10	G	A	15: 78,780,514	R747W	probably damaging	Het
Cdh8	T	A	8: 99,190,394	D363V	probably damaging	Het
Cecr2	T	C	6: 120,757,941	Y685H	probably damaging	Het
Cmklr1	T	C	5: 113,614,407	T178A	probably damaging	Het
Col16a1	G	A	4: 130,092,782		probably null	Het
Col4a1	C	T	8: 11,226,439		probably benign	Het
Coro2a	T	A	4: 46,548,797	I166F	possibly damaging	Het
Cry2	T	C	2: 92,424,566	H148R	probably damaging	Het
Crygd	T	C	1: 65,061,974	Y154C	probably benign	Het
Cubn	T	C	2: 13,308,561	Y3066C	probably damaging	Het
Defb15	C	T	8: 21,929,986	E42K	possibly damaging	Het
Dnah12	A	G	14: 26,697,398	D147G	probably benign	Het
Dnah12	A	T	14: 26,709,257	Y340F	probably benign	Het
Dot1l	G	T	10: 80,783,539	R193L	probably damaging	Het
Dupd1	A	G	14: 21,686,689	V115A	probably benign	Het
Esd	A	C	14: 74,742,074	Y119S	probably damaging	Het
Esp36	A	G	17: 38,419,439		probably benign	Het
Etfbkmt	T	A	6: 149,144,151	M1K	probably null	Het
Exph5	A	G	9: 53,376,248	H1543R	probably benign	Het
Fam92a	C	T	4: 12,155,717	V306I	possibly damaging	Het
Fbxo16	A	G	14: 65,270,803	T23A	probably damaging	Het
Gm11492	A	G	11: 87,567,235	H145R	possibly damaging	Het
Gm6614	T	C	6: 142,003,423	M76V	possibly damaging	Het
Gorasp2	C	A	2: 70,679,464	H136Q	probably damaging	Het
Hdc	T	A	2: 126,597,933	I367F	probably benign	Het
Hmcn1	C	T	1: 150,638,900	V3574M	probably benign	Het
Ilvbl	A	G	10: 78,584,124	D592G	probably benign	Het
Inmt	G	A	6: 55,174,883	A34V	probably damaging	Het
Ints9	A	C	14: 65,026,413	H378P	probably benign	Het
Kcnh7	T	A	2: 62,787,754	I464L	possibly damaging	Het
Kcnt2	T	A	1: 140,425,330	V259D	probably damaging	Het
Lipo1	A	G	19: 33,784,692	F135S	probably damaging	Het
Lrba	T	C	3: 86,773,203		probably null	Het
Mapk1	T	A	16: 17,026,429	S22T	probably benign	Het
Mbd3l2	T	C	9: 18,444,921	S181P	possibly damaging	Het
Mgat5	C	T	1: 127,459,969	P554L	probably damaging	Het
Mki67	T	C	7: 135,699,361	T1315A	probably benign	Het
Mprip	C	T	11: 59,758,221	T917M	possibly damaging	Het
Mroh3	T	A	1: 136,185,988	I688F	probably benign	Het
Myo1d	A	T	11: 80,663,048	Y536N	probably damaging	Het
Neb	C	T	2: 52,162,187		probably null	Het
Noc2l	A	G	4: 156,237,708	R161G	probably benign	Het
Nup54	T	A	5: 92,419,567	I375L	possibly damaging	Het
Nup93	T	C	8: 94,306,102	F539L	probably damaging	Het
Olfr138	A	G	17: 38,275,344	E191G	probably damaging	Het
Olfr417	T	A	1: 174,369,452	H178Q	probably damaging	Het
Olfr480	A	C	7: 108,066,725	Y24*	probably null	Het
Olfr874	T	A	9: 37,746,968	M278K	probably benign	Het
Panx1	A	T	9: 15,007,428	D378E	probably damaging	Het
Papss1	T	A	3: 131,583,184	V170D	possibly damaging	Het
Pcnx	T	C	12: 81,918,732	S558P	probably damaging	Het
Pde3a	T	A	6: 141,250,353	I255N	probably damaging	Het
Pde3a	G	T	6: 141,487,513	A757S	probably damaging	Het
Pdzph1	A	G	17: 58,922,583	Y1027H	probably damaging	Het
Pkhd1	G	T	1: 20,551,020	R805S	probably benign	Het
Polr1a	G	A	6: 71,909,203	G14D	probably damaging	Het
Prg4	T	A	1: 150,460,669	D60V	probably damaging	Het
Ptprc	T	C	1: 138,112,227	S311G	probably benign	Het
Rapgefl1	G	A	11: 98,842,209	R205K	probably benign	Het
Rcan2	A	T	17: 44,037,089		probably null	Het
Rock1	A	G	18: 10,079,207	I1087T	probably damaging	Het
Sectm1b	A	G	11: 121,054,942	I191T	possibly damaging	Het
Setd1b	T	C	5: 123,147,613	S241P	unknown	Het
Srpk2	T	C	5: 23,524,150	K497R	probably benign	Het
Sspo	T	C	6: 48,491,006	S4296P	probably damaging	Het
Syne4	T	C	7: 30,316,883	V168A	probably benign	Het
Tank	T	C	2: 61,649,912	F264S	probably damaging	Het
Ticrr	T	C	7: 79,695,207	S1607P	probably damaging	Het
Trim30a	A	G	7: 104,411,198	V457A	probably damaging	Het
Trim43b	T	A	9: 89,085,571	K336N	probably damaging	Het
Trim47	T	C	11: 116,106,137	Q598R	probably damaging	Het
Tspan12	T	C	6: 21,851,023	N18S	probably damaging	Het
Vit	A	G	17: 78,622,746	D380G	probably damaging	Het
Vmn2r2	T	C	3: 64,134,521	N258D	possibly damaging	Het
Vmn2r52	C	T	7: 10,173,406	C131Y	possibly damaging	Het
Zadh2	T	C	18: 84,095,318	V373A	possibly damaging	Het
Zfp58	A	T	13: 67,491,188	F395I	probably damaging	Het
Zfp940	C	A	7: 29,845,010	G491C	probably damaging	Het

Other mutations in Ubap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Ubap2	APN	4	41195328	splice site	probably benign
IGL01109:Ubap2	APN	4	41195155	missense	probably damaging	1.00
IGL01354:Ubap2	APN	4	41207005	missense	probably damaging	1.00
IGL01563:Ubap2	APN	4	41195998	missense	probably damaging	0.96
IGL01602:Ubap2	APN	4	41227237	missense	probably damaging	1.00
IGL01605:Ubap2	APN	4	41227237	missense	probably damaging	1.00
IGL01688:Ubap2	APN	4	41226308	missense	probably benign
IGL01733:Ubap2	APN	4	41195862	unclassified	probably benign
IGL01896:Ubap2	APN	4	41202362	missense	possibly damaging	0.85
IGL01942:Ubap2	APN	4	41251608	missense	probably benign	0.00
IGL02095:Ubap2	APN	4	41229709	missense	probably benign
R0608:Ubap2	UTSW	4	41218319	missense	probably benign	0.10
R0938:Ubap2	UTSW	4	41202304	missense	probably damaging	1.00
R1449:Ubap2	UTSW	4	41209351	critical splice donor site	probably null
R1484:Ubap2	UTSW	4	41235593	missense	probably damaging	1.00
R1548:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1549:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1604:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1607:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1739:Ubap2	UTSW	4	41206849	missense	probably benign	0.00
R1772:Ubap2	UTSW	4	41202380	missense	probably benign	0.02
R1869:Ubap2	UTSW	4	41233617	missense	probably damaging	1.00
R1886:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R1887:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2063:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2064:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2065:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2066:Ubap2	UTSW	4	41199872	missense	probably benign	0.12
R2095:Ubap2	UTSW	4	41206901	missense	possibly damaging	0.68
R2214:Ubap2	UTSW	4	41199714	critical splice donor site	probably null
R2215:Ubap2	UTSW	4	41196483	splice site	probably null
R2318:Ubap2	UTSW	4	41251542	missense	probably damaging	0.99
R3755:Ubap2	UTSW	4	41195482	missense	probably damaging	1.00
R4620:Ubap2	UTSW	4	41233698	missense	probably damaging	1.00
R4717:Ubap2	UTSW	4	41218333	missense	possibly damaging	0.93
R4756:Ubap2	UTSW	4	41211771	missense	probably damaging	1.00
R4942:Ubap2	UTSW	4	41245461	intron	probably benign
R5344:Ubap2	UTSW	4	41251578	missense	possibly damaging	0.46
R5763:Ubap2	UTSW	4	41195809	missense	probably damaging	1.00
R5851:Ubap2	UTSW	4	41206268	nonsense	probably null
R5951:Ubap2	UTSW	4	41205753	splice site	probably null
R6178:Ubap2	UTSW	4	41206981	missense	probably benign
R6489:Ubap2	UTSW	4	41203574	critical splice acceptor site	probably null
R6520:Ubap2	UTSW	4	41195155	missense	probably damaging	1.00
R6652:Ubap2	UTSW	4	41196743	missense	possibly damaging	0.68
R6702:Ubap2	UTSW	4	41227210	small insertion	probably benign
R6736:Ubap2	UTSW	4	41227210	small insertion	probably benign
R6736:Ubap2	UTSW	4	41227224	small insertion	probably benign
R6860:Ubap2	UTSW	4	41233631	missense	probably damaging	1.00
R7007:Ubap2	UTSW	4	41206221	missense	probably damaging	0.97
R7048:Ubap2	UTSW	4	41196033	missense	possibly damaging	0.49
R7121:Ubap2	UTSW	4	41205550	missense	probably benign	0.00
R7371:Ubap2	UTSW	4	41195779	missense	probably benign	0.16
R7378:Ubap2	UTSW	4	41235515	critical splice donor site	probably null
R7695:Ubap2	UTSW	4	41211740	missense	probably damaging	0.98
R7811:Ubap2	UTSW	4	41211710	missense	probably benign	0.22
R7828:Ubap2	UTSW	4	41221615	missense	probably benign	0.00
R7838:Ubap2	UTSW	4	41233655	missense	probably damaging	1.00
R8016:Ubap2	UTSW	4	41195201	missense	possibly damaging	0.91
R8790:Ubap2	UTSW	4	41209351	critical splice donor site	probably null
R8817:Ubap2	UTSW	4	41223425	missense	possibly damaging	0.66
R9379:Ubap2	UTSW	4	41216630	missense	possibly damaging	0.67
R9470:Ubap2	UTSW	4	41195434	missense	possibly damaging	0.64
R9536:Ubap2	UTSW	4	41195661	missense	probably benign	0.01
X0061:Ubap2	UTSW	4	41196507	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGTCAAACTCAAACCTAGGCC -3'
(R):5'- CCAATCCAGCGTAGTCAGAC -3'

Sequencing Primer
(F):5'- GCCTCAGGAAGTCTACGTGAAC -3'
(R):5'- CCAGCGTAGTCAGACATTTAATAC -3'

Posted On

2014-06-23