Mutagenetix > Incidental Mutation

Incidental Mutation 'R1862:Panx1'

204041

Institutional Source

Beutler Lab

Gene Symbol

Panx1

Ensembl Gene

ENSMUSG00000031934

Gene Name

pannexin 1

Synonyms

MMRRC Submission

039885-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1862 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15002128-15045478 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 15007428 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 378 (D378E)

Ref Sequence

ENSEMBL: ENSMUSP00000126405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056755] [ENSMUST00000164273] [ENSMUST00000169288]

AlphaFold

Q9JIP4

Predicted Effect

probably benign
Transcript: ENSMUST00000056755

SMART Domains

Protein: ENSMUSP00000053557
Gene: ENSMUSG00000031934

Domain	Start	End	E-Value	Type
Pfam:Innexin	31	102	1.2e-8	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000164273
AA Change: D378E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126405
Gene: ENSMUSG00000031934
AA Change: D378E

Domain	Start	End	E-Value	Type
Pfam:Innexin	33	256	2.1e-16	PFAM
transmembrane domain	274	296	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166933

Predicted Effect

probably benign
Transcript: ENSMUST00000169288

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.9%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are the structural components of gap junctions. This protein and pannexin 2 are abundantly expressed in central nerve system (CNS) and are coexpressed in various neuronal populations. Studies in Xenopus oocytes suggest that this protein alone and in combination with pannexin 2 may form cell type-specific gap junctions with distinct properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired macrophage recruitment, YO-PRO-1 dye uptake, ATP release by apoptotic thymocytes, hippocampal neurons, and astrocytes. Mice homozygous for a different knock-out allele exhibit protection from I/R-induced retinal ganglion cell loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	A	14: 8,241,416	E565D	probably benign	Het
Adam30	A	T	3: 98,162,113	K421*	probably null	Het
Atp6v1b1	A	G	6: 83,749,852		probably null	Het
Cacna1a	A	T	8: 84,415,930	I96F	possibly damaging	Het
Card10	G	A	15: 78,780,514	R747W	probably damaging	Het
Cdh8	T	A	8: 99,190,394	D363V	probably damaging	Het
Cecr2	T	C	6: 120,757,941	Y685H	probably damaging	Het
Cmklr1	T	C	5: 113,614,407	T178A	probably damaging	Het
Col16a1	G	A	4: 130,092,782		probably null	Het
Col4a1	C	T	8: 11,226,439		probably benign	Het
Coro2a	T	A	4: 46,548,797	I166F	possibly damaging	Het
Cry2	T	C	2: 92,424,566	H148R	probably damaging	Het
Crygd	T	C	1: 65,061,974	Y154C	probably benign	Het
Cubn	T	C	2: 13,308,561	Y3066C	probably damaging	Het
Defb15	C	T	8: 21,929,986	E42K	possibly damaging	Het
Dnah12	A	G	14: 26,697,398	D147G	probably benign	Het
Dnah12	A	T	14: 26,709,257	Y340F	probably benign	Het
Dot1l	G	T	10: 80,783,539	R193L	probably damaging	Het
Dupd1	A	G	14: 21,686,689	V115A	probably benign	Het
Esd	A	C	14: 74,742,074	Y119S	probably damaging	Het
Esp36	A	G	17: 38,419,439		probably benign	Het
Etfbkmt	T	A	6: 149,144,151	M1K	probably null	Het
Exph5	A	G	9: 53,376,248	H1543R	probably benign	Het
Fam92a	C	T	4: 12,155,717	V306I	possibly damaging	Het
Fbxo16	A	G	14: 65,270,803	T23A	probably damaging	Het
Gm11492	A	G	11: 87,567,235	H145R	possibly damaging	Het
Gm6614	T	C	6: 142,003,423	M76V	possibly damaging	Het
Gorasp2	C	A	2: 70,679,464	H136Q	probably damaging	Het
Hdc	T	A	2: 126,597,933	I367F	probably benign	Het
Hmcn1	C	T	1: 150,638,900	V3574M	probably benign	Het
Ilvbl	A	G	10: 78,584,124	D592G	probably benign	Het
Inmt	G	A	6: 55,174,883	A34V	probably damaging	Het
Ints9	A	C	14: 65,026,413	H378P	probably benign	Het
Kcnh7	T	A	2: 62,787,754	I464L	possibly damaging	Het
Kcnt2	T	A	1: 140,425,330	V259D	probably damaging	Het
Lipo1	A	G	19: 33,784,692	F135S	probably damaging	Het
Lrba	T	C	3: 86,773,203		probably null	Het
Mapk1	T	A	16: 17,026,429	S22T	probably benign	Het
Mbd3l2	T	C	9: 18,444,921	S181P	possibly damaging	Het
Mgat5	C	T	1: 127,459,969	P554L	probably damaging	Het
Mki67	T	C	7: 135,699,361	T1315A	probably benign	Het
Mprip	C	T	11: 59,758,221	T917M	possibly damaging	Het
Mroh3	T	A	1: 136,185,988	I688F	probably benign	Het
Myo1d	A	T	11: 80,663,048	Y536N	probably damaging	Het
Neb	C	T	2: 52,162,187		probably null	Het
Noc2l	A	G	4: 156,237,708	R161G	probably benign	Het
Nup54	T	A	5: 92,419,567	I375L	possibly damaging	Het
Nup93	T	C	8: 94,306,102	F539L	probably damaging	Het
Olfr138	A	G	17: 38,275,344	E191G	probably damaging	Het
Olfr417	T	A	1: 174,369,452	H178Q	probably damaging	Het
Olfr480	A	C	7: 108,066,725	Y24*	probably null	Het
Olfr874	T	A	9: 37,746,968	M278K	probably benign	Het
Papss1	T	A	3: 131,583,184	V170D	possibly damaging	Het
Pcnx	T	C	12: 81,918,732	S558P	probably damaging	Het
Pde3a	T	A	6: 141,250,353	I255N	probably damaging	Het
Pde3a	G	T	6: 141,487,513	A757S	probably damaging	Het
Pdzph1	A	G	17: 58,922,583	Y1027H	probably damaging	Het
Pkhd1	G	T	1: 20,551,020	R805S	probably benign	Het
Polr1a	G	A	6: 71,909,203	G14D	probably damaging	Het
Prg4	T	A	1: 150,460,669	D60V	probably damaging	Het
Ptprc	T	C	1: 138,112,227	S311G	probably benign	Het
Rapgefl1	G	A	11: 98,842,209	R205K	probably benign	Het
Rcan2	A	T	17: 44,037,089		probably null	Het
Rock1	A	G	18: 10,079,207	I1087T	probably damaging	Het
Sectm1b	A	G	11: 121,054,942	I191T	possibly damaging	Het
Setd1b	T	C	5: 123,147,613	S241P	unknown	Het
Srpk2	T	C	5: 23,524,150	K497R	probably benign	Het
Sspo	T	C	6: 48,491,006	S4296P	probably damaging	Het
Syne4	T	C	7: 30,316,883	V168A	probably benign	Het
Tank	T	C	2: 61,649,912	F264S	probably damaging	Het
Ticrr	T	C	7: 79,695,207	S1607P	probably damaging	Het
Trim30a	A	G	7: 104,411,198	V457A	probably damaging	Het
Trim43b	T	A	9: 89,085,571	K336N	probably damaging	Het
Trim47	T	C	11: 116,106,137	Q598R	probably damaging	Het
Tspan12	T	C	6: 21,851,023	N18S	probably damaging	Het
Ubap2	A	G	4: 41,221,607	S231P	probably benign	Het
Vit	A	G	17: 78,622,746	D380G	probably damaging	Het
Vmn2r2	T	C	3: 64,134,521	N258D	possibly damaging	Het
Vmn2r52	C	T	7: 10,173,406	C131Y	possibly damaging	Het
Zadh2	T	C	18: 84,095,318	V373A	possibly damaging	Het
Zfp58	A	T	13: 67,491,188	F395I	probably damaging	Het
Zfp940	C	A	7: 29,845,010	G491C	probably damaging	Het

Other mutations in Panx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00835:Panx1	APN	9	15007844	missense	probably damaging	0.97
IGL01364:Panx1	APN	9	15021465	missense	probably damaging	1.00
IGL02831:Panx1	APN	9	15007648	missense	probably damaging	1.00
IGL02861:Panx1	APN	9	15007805	missense	probably benign
cathedral	UTSW	9	15007633	missense	possibly damaging	0.53
elephant	UTSW	9	15010217	missense	probably damaging	1.00
notre_dame	UTSW	9	15010217	missense	probably damaging	1.00
R0422:Panx1	UTSW	9	15007816	nonsense	probably null
R0602:Panx1	UTSW	9	15010204	missense	probably damaging	1.00
R1509:Panx1	UTSW	9	15010045	missense	possibly damaging	0.53
R1681:Panx1	UTSW	9	15007783	missense	probably benign	0.13
R1895:Panx1	UTSW	9	15007526	missense	probably benign	0.13
R1937:Panx1	UTSW	9	15007684	missense	possibly damaging	0.68
R1946:Panx1	UTSW	9	15007526	missense	probably benign	0.13
R2447:Panx1	UTSW	9	15044889	missense	probably damaging	0.99
R3732:Panx1	UTSW	9	15006171	unclassified	probably benign
R3732:Panx1	UTSW	9	15006171	unclassified	probably benign
R3733:Panx1	UTSW	9	15006171	unclassified	probably benign
R3734:Panx1	UTSW	9	15006171	unclassified	probably benign
R3958:Panx1	UTSW	9	15006171	unclassified	probably benign
R3960:Panx1	UTSW	9	15006171	unclassified	probably benign
R4744:Panx1	UTSW	9	15010298	intron	probably benign
R4990:Panx1	UTSW	9	15010217	missense	probably damaging	1.00
R5272:Panx1	UTSW	9	15044856	critical splice donor site	probably null
R5556:Panx1	UTSW	9	15007633	missense	possibly damaging	0.53
R5935:Panx1	UTSW	9	15010217	missense	probably damaging	1.00
R6126:Panx1	UTSW	9	15007790	missense	probably benign	0.38
R6683:Panx1	UTSW	9	15008011	missense	probably benign	0.41
R6743:Panx1	UTSW	9	15007633	missense	possibly damaging	0.53
R6873:Panx1	UTSW	9	15010217	missense	probably damaging	1.00
R7944:Panx1	UTSW	9	15007829	missense	probably damaging	1.00
R8061:Panx1	UTSW	9	15045001	missense	possibly damaging	0.58
Z1177:Panx1	UTSW	9	15007814	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTAGGATAACACCAATTTGTCCCTG -3'
(R):5'- AATCCTGCCCACCTTCGATG -3'

Sequencing Primer
(F):5'- GATAACACCAATTTGTCCCTGTATCC -3'
(R):5'- GTTCTACATTTCAAGTCTGAAGGC -3'

Posted On

2014-06-23