Mutagenetix > Incidental Mutation

Incidental Mutation 'R1862:Exph5'

204044

Institutional Source

Beutler Lab

Gene Symbol

Exph5

Ensembl Gene

ENSMUSG00000034584

Gene Name

exophilin 5

Synonyms

Slac2b, AC079869.22gm5, B130009M24Rik, slac2-b

MMRRC Submission

039885-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1862 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

53301670-53377514 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 53376248 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 1543 (H1543R)

Ref Sequence

ENSEMBL: ENSMUSP00000062632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051014]

AlphaFold

Q0VAV2

Predicted Effect

probably benign
Transcript: ENSMUST00000051014
AA Change: H1543R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: H1543R

Domain	Start	End	E-Value	Type
low complexity region	112	131	N/A	INTRINSIC
low complexity region	454	469	N/A	INTRINSIC
low complexity region	673	682	N/A	INTRINSIC
low complexity region	970	980	N/A	INTRINSIC
low complexity region	1556	1568	N/A	INTRINSIC
low complexity region	1747	1757	N/A	INTRINSIC
low complexity region	1937	1959	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.9%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	A	14: 8,241,416	E565D	probably benign	Het
Adam30	A	T	3: 98,162,113	K421*	probably null	Het
Atp6v1b1	A	G	6: 83,749,852		probably null	Het
Cacna1a	A	T	8: 84,415,930	I96F	possibly damaging	Het
Card10	G	A	15: 78,780,514	R747W	probably damaging	Het
Cdh8	T	A	8: 99,190,394	D363V	probably damaging	Het
Cecr2	T	C	6: 120,757,941	Y685H	probably damaging	Het
Cmklr1	T	C	5: 113,614,407	T178A	probably damaging	Het
Col16a1	G	A	4: 130,092,782		probably null	Het
Col4a1	C	T	8: 11,226,439		probably benign	Het
Coro2a	T	A	4: 46,548,797	I166F	possibly damaging	Het
Cry2	T	C	2: 92,424,566	H148R	probably damaging	Het
Crygd	T	C	1: 65,061,974	Y154C	probably benign	Het
Cubn	T	C	2: 13,308,561	Y3066C	probably damaging	Het
Defb15	C	T	8: 21,929,986	E42K	possibly damaging	Het
Dnah12	A	G	14: 26,697,398	D147G	probably benign	Het
Dnah12	A	T	14: 26,709,257	Y340F	probably benign	Het
Dot1l	G	T	10: 80,783,539	R193L	probably damaging	Het
Dupd1	A	G	14: 21,686,689	V115A	probably benign	Het
Esd	A	C	14: 74,742,074	Y119S	probably damaging	Het
Esp36	A	G	17: 38,419,439		probably benign	Het
Etfbkmt	T	A	6: 149,144,151	M1K	probably null	Het
Fam92a	C	T	4: 12,155,717	V306I	possibly damaging	Het
Fbxo16	A	G	14: 65,270,803	T23A	probably damaging	Het
Gm11492	A	G	11: 87,567,235	H145R	possibly damaging	Het
Gm6614	T	C	6: 142,003,423	M76V	possibly damaging	Het
Gorasp2	C	A	2: 70,679,464	H136Q	probably damaging	Het
Hdc	T	A	2: 126,597,933	I367F	probably benign	Het
Hmcn1	C	T	1: 150,638,900	V3574M	probably benign	Het
Ilvbl	A	G	10: 78,584,124	D592G	probably benign	Het
Inmt	G	A	6: 55,174,883	A34V	probably damaging	Het
Ints9	A	C	14: 65,026,413	H378P	probably benign	Het
Kcnh7	T	A	2: 62,787,754	I464L	possibly damaging	Het
Kcnt2	T	A	1: 140,425,330	V259D	probably damaging	Het
Lipo1	A	G	19: 33,784,692	F135S	probably damaging	Het
Lrba	T	C	3: 86,773,203		probably null	Het
Mapk1	T	A	16: 17,026,429	S22T	probably benign	Het
Mbd3l2	T	C	9: 18,444,921	S181P	possibly damaging	Het
Mgat5	C	T	1: 127,459,969	P554L	probably damaging	Het
Mki67	T	C	7: 135,699,361	T1315A	probably benign	Het
Mprip	C	T	11: 59,758,221	T917M	possibly damaging	Het
Mroh3	T	A	1: 136,185,988	I688F	probably benign	Het
Myo1d	A	T	11: 80,663,048	Y536N	probably damaging	Het
Neb	C	T	2: 52,162,187		probably null	Het
Noc2l	A	G	4: 156,237,708	R161G	probably benign	Het
Nup54	T	A	5: 92,419,567	I375L	possibly damaging	Het
Nup93	T	C	8: 94,306,102	F539L	probably damaging	Het
Olfr138	A	G	17: 38,275,344	E191G	probably damaging	Het
Olfr417	T	A	1: 174,369,452	H178Q	probably damaging	Het
Olfr480	A	C	7: 108,066,725	Y24*	probably null	Het
Olfr874	T	A	9: 37,746,968	M278K	probably benign	Het
Panx1	A	T	9: 15,007,428	D378E	probably damaging	Het
Papss1	T	A	3: 131,583,184	V170D	possibly damaging	Het
Pcnx	T	C	12: 81,918,732	S558P	probably damaging	Het
Pde3a	T	A	6: 141,250,353	I255N	probably damaging	Het
Pde3a	G	T	6: 141,487,513	A757S	probably damaging	Het
Pdzph1	A	G	17: 58,922,583	Y1027H	probably damaging	Het
Pkhd1	G	T	1: 20,551,020	R805S	probably benign	Het
Polr1a	G	A	6: 71,909,203	G14D	probably damaging	Het
Prg4	T	A	1: 150,460,669	D60V	probably damaging	Het
Ptprc	T	C	1: 138,112,227	S311G	probably benign	Het
Rapgefl1	G	A	11: 98,842,209	R205K	probably benign	Het
Rcan2	A	T	17: 44,037,089		probably null	Het
Rock1	A	G	18: 10,079,207	I1087T	probably damaging	Het
Sectm1b	A	G	11: 121,054,942	I191T	possibly damaging	Het
Setd1b	T	C	5: 123,147,613	S241P	unknown	Het
Srpk2	T	C	5: 23,524,150	K497R	probably benign	Het
Sspo	T	C	6: 48,491,006	S4296P	probably damaging	Het
Syne4	T	C	7: 30,316,883	V168A	probably benign	Het
Tank	T	C	2: 61,649,912	F264S	probably damaging	Het
Ticrr	T	C	7: 79,695,207	S1607P	probably damaging	Het
Trim30a	A	G	7: 104,411,198	V457A	probably damaging	Het
Trim43b	T	A	9: 89,085,571	K336N	probably damaging	Het
Trim47	T	C	11: 116,106,137	Q598R	probably damaging	Het
Tspan12	T	C	6: 21,851,023	N18S	probably damaging	Het
Ubap2	A	G	4: 41,221,607	S231P	probably benign	Het
Vit	A	G	17: 78,622,746	D380G	probably damaging	Het
Vmn2r2	T	C	3: 64,134,521	N258D	possibly damaging	Het
Vmn2r52	C	T	7: 10,173,406	C131Y	possibly damaging	Het
Zadh2	T	C	18: 84,095,318	V373A	possibly damaging	Het
Zfp58	A	T	13: 67,491,188	F395I	probably damaging	Het
Zfp940	C	A	7: 29,845,010	G491C	probably damaging	Het

Other mutations in Exph5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Exph5	APN	9	53376706	nonsense	probably null
IGL01387:Exph5	APN	9	53373965	missense	possibly damaging	0.95
IGL01985:Exph5	APN	9	53376569	missense	probably damaging	0.99
IGL02122:Exph5	APN	9	53373674	missense	probably benign	0.05
IGL02156:Exph5	APN	9	53375641	missense	probably damaging	0.96
IGL02192:Exph5	APN	9	53376325	nonsense	probably null
IGL02491:Exph5	APN	9	53375043	missense	possibly damaging	0.89
PIT4802001:Exph5	UTSW	9	53374978	missense	probably damaging	0.96
R0002:Exph5	UTSW	9	53373956	missense	probably damaging	0.99
R0026:Exph5	UTSW	9	53376479	missense	probably benign	0.38
R0086:Exph5	UTSW	9	53337930	missense	possibly damaging	0.90
R0152:Exph5	UTSW	9	53353204	critical splice donor site	probably null
R0369:Exph5	UTSW	9	53373302	missense	probably benign	0.35
R0409:Exph5	UTSW	9	53374343	missense	probably benign	0.00
R0517:Exph5	UTSW	9	53372762	missense	probably benign	0.02
R0658:Exph5	UTSW	9	53377475	missense	unknown
R1606:Exph5	UTSW	9	53374295	missense	probably benign	0.37
R1739:Exph5	UTSW	9	53375588	missense	possibly damaging	0.62
R1769:Exph5	UTSW	9	53373809	missense	probably benign	0.35
R1828:Exph5	UTSW	9	53376641	missense	possibly damaging	0.79
R1993:Exph5	UTSW	9	53373635	missense	possibly damaging	0.79
R2012:Exph5	UTSW	9	53367166	missense	possibly damaging	0.49
R2044:Exph5	UTSW	9	53372679	missense	possibly damaging	0.79
R2402:Exph5	UTSW	9	53374925	nonsense	probably null
R3817:Exph5	UTSW	9	53375494	nonsense	probably null
R4771:Exph5	UTSW	9	53373665	missense	possibly damaging	0.95
R4869:Exph5	UTSW	9	53376239	missense	possibly damaging	0.73
R4926:Exph5	UTSW	9	53376625	missense	possibly damaging	0.95
R4996:Exph5	UTSW	9	53375610	missense	possibly damaging	0.79
R5254:Exph5	UTSW	9	53337930	missense	probably damaging	0.99
R5522:Exph5	UTSW	9	53374313	missense	possibly damaging	0.90
R5947:Exph5	UTSW	9	53375222	missense	probably benign	0.04
R5961:Exph5	UTSW	9	53377255	missense	probably damaging	1.00
R6093:Exph5	UTSW	9	53372617	missense	possibly damaging	0.94
R6144:Exph5	UTSW	9	53373028	missense	probably benign	0.21
R6254:Exph5	UTSW	9	53372710	missense	possibly damaging	0.81
R6279:Exph5	UTSW	9	53373946	missense	possibly damaging	0.78
R6300:Exph5	UTSW	9	53373946	missense	possibly damaging	0.78
R6485:Exph5	UTSW	9	53376691	missense	possibly damaging	0.89
R6553:Exph5	UTSW	9	53301712	start gained	probably benign
R6792:Exph5	UTSW	9	53375317	missense	possibly damaging	0.52
R7026:Exph5	UTSW	9	53340428	missense	probably benign	0.27
R7340:Exph5	UTSW	9	53377009	missense	probably damaging	0.99
R7347:Exph5	UTSW	9	53375896	missense	possibly damaging	0.79
R7352:Exph5	UTSW	9	53375722	missense	probably benign	0.00
R7520:Exph5	UTSW	9	53367214	critical splice donor site	probably null
R7521:Exph5	UTSW	9	53374077	missense	possibly damaging	0.89
R7560:Exph5	UTSW	9	53375773	missense	probably benign	0.41
R7581:Exph5	UTSW	9	53372557	missense	possibly damaging	0.90
R7726:Exph5	UTSW	9	53373175	missense	possibly damaging	0.62
R7976:Exph5	UTSW	9	53376635	missense	possibly damaging	0.79
R8017:Exph5	UTSW	9	53373452	missense	probably benign
R8019:Exph5	UTSW	9	53373452	missense	probably benign
R8302:Exph5	UTSW	9	53376476	missense	possibly damaging	0.89
R8420:Exph5	UTSW	9	53375848	nonsense	probably null
R8551:Exph5	UTSW	9	53374051	missense	possibly damaging	0.94
R8708:Exph5	UTSW	9	53375796	missense	probably benign
R8889:Exph5	UTSW	9	53376655	missense	probably damaging	1.00
R9048:Exph5	UTSW	9	53373635	missense	possibly damaging	0.79
R9255:Exph5	UTSW	9	53373309	missense	possibly damaging	0.79
R9727:Exph5	UTSW	9	53376402	missense	probably damaging	0.96
X0028:Exph5	UTSW	9	53376263	missense	probably damaging	1.00
Z1177:Exph5	UTSW	9	53374213	missense	probably benign	0.44
Z1177:Exph5	UTSW	9	53377419	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGGTCAGACTGCCAAAAC -3'
(R):5'- AGCCAGATTCGCTTTCACTTTG -3'

Sequencing Primer
(F):5'- CCCGACTGATAAAATGCTCTCTG -3'
(R):5'- TCACTTTGGGAGAAGATAGTAGCTAC -3'

Posted On

2014-06-23