Incidental Mutation 'R1862:Mprip'
ID 204050
Institutional Source Beutler Lab
Gene Symbol Mprip
Ensembl Gene ENSMUSG00000005417
Gene Name myosin phosphatase Rho interacting protein
Synonyms p116 Rho interacting protein, p116Rip, Gm34094, RIP3, Rhoip3
MMRRC Submission 039885-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.669) question?
Stock # R1862 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 59552973-59671686 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 59649047 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 917 (T917M)
Ref Sequence ENSEMBL: ENSMUSP00000071081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066330] [ENSMUST00000072031] [ENSMUST00000108751] [ENSMUST00000116371] [ENSMUST00000133861]
AlphaFold P97434
Predicted Effect possibly damaging
Transcript: ENSMUST00000066330
AA Change: T917M

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000071081
Gene: ENSMUSG00000005417
AA Change: T917M

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 249 320 1e-10 BLAST
PH 351 448 3.76e-18 SMART
low complexity region 492 501 N/A INTRINSIC
low complexity region 536 555 N/A INTRINSIC
coiled coil region 636 671 N/A INTRINSIC
Blast:PAC 806 848 2e-10 BLAST
low complexity region 1005 1023 N/A INTRINSIC
low complexity region 1047 1059 N/A INTRINSIC
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1183 1200 N/A INTRINSIC
coiled coil region 1267 1300 N/A INTRINSIC
coiled coil region 1617 1642 N/A INTRINSIC
coiled coil region 1729 1779 N/A INTRINSIC
coiled coil region 1899 1936 N/A INTRINSIC
coiled coil region 1960 2110 N/A INTRINSIC
coiled coil region 2132 2206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072031
SMART Domains Protein: ENSMUSP00000071914
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108751
SMART Domains Protein: ENSMUSP00000104382
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 183 196 N/A INTRINSIC
Blast:PH 216 282 1e-10 BLAST
PH 349 446 3.76e-18 SMART
low complexity region 490 499 N/A INTRINSIC
low complexity region 534 553 N/A INTRINSIC
coiled coil region 634 669 N/A INTRINSIC
coiled coil region 690 840 N/A INTRINSIC
coiled coil region 862 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116371
SMART Domains Protein: ENSMUSP00000112072
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
PH 44 152 3.33e-10 SMART
low complexity region 179 190 N/A INTRINSIC
low complexity region 221 234 N/A INTRINSIC
Blast:PH 254 320 1e-10 BLAST
PH 387 484 3.76e-18 SMART
low complexity region 528 537 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
coiled coil region 672 707 N/A INTRINSIC
coiled coil region 728 878 N/A INTRINSIC
coiled coil region 900 974 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132620
SMART Domains Protein: ENSMUSP00000119422
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Blast:PH 101 167 9e-11 BLAST
PH 198 295 3.76e-18 SMART
low complexity region 339 348 N/A INTRINSIC
low complexity region 383 402 N/A INTRINSIC
coiled coil region 482 517 N/A INTRINSIC
coiled coil region 538 688 N/A INTRINSIC
coiled coil region 710 784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133861
SMART Domains Protein: ENSMUSP00000119562
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
low complexity region 18 29 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 89 102 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
PH 373 470 3.76e-18 SMART
low complexity region 514 523 N/A INTRINSIC
low complexity region 558 577 N/A INTRINSIC
coiled coil region 658 693 N/A INTRINSIC
coiled coil region 714 864 N/A INTRINSIC
coiled coil region 886 960 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156111
SMART Domains Protein: ENSMUSP00000114446
Gene: ENSMUSG00000005417

DomainStartEndE-ValueType
internal_repeat_1 5 38 1.61e-7 PROSPERO
internal_repeat_2 9 51 2.4e-6 PROSPERO
internal_repeat_1 59 92 1.61e-7 PROSPERO
internal_repeat_2 85 129 2.4e-6 PROSPERO
coiled coil region 140 177 N/A INTRINSIC
coiled coil region 201 351 N/A INTRINSIC
coiled coil region 373 447 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 (GRCm38) E565D probably benign Het
Adam30 A T 3: 98,069,429 (GRCm39) K421* probably null Het
Atp6v1b1 A G 6: 83,726,834 (GRCm39) probably null Het
Cacna1a A T 8: 85,142,559 (GRCm39) I96F possibly damaging Het
Card10 G A 15: 78,664,714 (GRCm39) R747W probably damaging Het
Cdh8 T A 8: 99,917,026 (GRCm39) D363V probably damaging Het
Cecr2 T C 6: 120,734,902 (GRCm39) Y685H probably damaging Het
Cibar1 C T 4: 12,155,717 (GRCm39) V306I possibly damaging Het
Cmklr1 T C 5: 113,752,468 (GRCm39) T178A probably damaging Het
Col16a1 G A 4: 129,986,575 (GRCm39) probably null Het
Col4a1 C T 8: 11,276,439 (GRCm39) probably benign Het
Coro2a T A 4: 46,548,797 (GRCm39) I166F possibly damaging Het
Cry2 T C 2: 92,254,911 (GRCm39) H148R probably damaging Het
Crygd T C 1: 65,101,133 (GRCm39) Y154C probably benign Het
Cubn T C 2: 13,313,372 (GRCm39) Y3066C probably damaging Het
Defb15 C T 8: 22,420,002 (GRCm39) E42K possibly damaging Het
Dnah12 A G 14: 26,418,553 (GRCm39) D147G probably benign Het
Dnah12 A T 14: 26,430,412 (GRCm39) Y340F probably benign Het
Dot1l G T 10: 80,619,373 (GRCm39) R193L probably damaging Het
Dusp29 A G 14: 21,736,757 (GRCm39) V115A probably benign Het
Esd A C 14: 74,979,514 (GRCm39) Y119S probably damaging Het
Esp36 A G 17: 38,730,330 (GRCm39) probably benign Het
Etfbkmt T A 6: 149,045,649 (GRCm39) M1K probably null Het
Exph5 A G 9: 53,287,548 (GRCm39) H1543R probably benign Het
Fbxo16 A G 14: 65,508,252 (GRCm39) T23A probably damaging Het
Gorasp2 C A 2: 70,509,808 (GRCm39) H136Q probably damaging Het
Hdc T A 2: 126,439,853 (GRCm39) I367F probably benign Het
Hmcn1 C T 1: 150,514,651 (GRCm39) V3574M probably benign Het
Ilvbl A G 10: 78,419,958 (GRCm39) D592G probably benign Het
Inmt G A 6: 55,151,868 (GRCm39) A34V probably damaging Het
Ints9 A C 14: 65,263,862 (GRCm39) H378P probably benign Het
Kcnh7 T A 2: 62,618,098 (GRCm39) I464L possibly damaging Het
Kcnt2 T A 1: 140,353,068 (GRCm39) V259D probably damaging Het
Lipo3 A G 19: 33,762,092 (GRCm39) F135S probably damaging Het
Lrba T C 3: 86,680,510 (GRCm39) probably null Het
Mapk1 T A 16: 16,844,293 (GRCm39) S22T probably benign Het
Mbd3l2 T C 9: 18,356,217 (GRCm39) S181P possibly damaging Het
Mgat5 C T 1: 127,387,706 (GRCm39) P554L probably damaging Het
Mki67 T C 7: 135,301,090 (GRCm39) T1315A probably benign Het
Mroh3 T A 1: 136,113,726 (GRCm39) I688F probably benign Het
Myo1d A T 11: 80,553,874 (GRCm39) Y536N probably damaging Het
Neb C T 2: 52,052,199 (GRCm39) probably null Het
Noc2l A G 4: 156,322,165 (GRCm39) R161G probably benign Het
Nup54 T A 5: 92,567,426 (GRCm39) I375L possibly damaging Het
Nup93 T C 8: 95,032,730 (GRCm39) F539L probably damaging Het
Or10x1 T A 1: 174,197,018 (GRCm39) H178Q probably damaging Het
Or2n1e A G 17: 38,586,235 (GRCm39) E191G probably damaging Het
Or5p57 A C 7: 107,665,932 (GRCm39) Y24* probably null Het
Or8b12 T A 9: 37,658,264 (GRCm39) M278K probably benign Het
Panx1 A T 9: 14,918,724 (GRCm39) D378E probably damaging Het
Papss1 T A 3: 131,288,945 (GRCm39) V170D possibly damaging Het
Pcnx1 T C 12: 81,965,506 (GRCm39) S558P probably damaging Het
Pde3a G T 6: 141,433,239 (GRCm39) A757S probably damaging Het
Pde3a T A 6: 141,196,079 (GRCm39) I255N probably damaging Het
Pdzph1 A G 17: 59,229,578 (GRCm39) Y1027H probably damaging Het
Pkhd1 G T 1: 20,621,244 (GRCm39) R805S probably benign Het
Polr1a G A 6: 71,886,187 (GRCm39) G14D probably damaging Het
Prg4 T A 1: 150,336,420 (GRCm39) D60V probably damaging Het
Ptgr3 T C 18: 84,113,443 (GRCm39) V373A possibly damaging Het
Ptprc T C 1: 138,039,965 (GRCm39) S311G probably benign Het
Rapgefl1 G A 11: 98,733,035 (GRCm39) R205K probably benign Het
Rcan2 A T 17: 44,347,980 (GRCm39) probably null Het
Rock1 A G 18: 10,079,207 (GRCm39) I1087T probably damaging Het
Sectm1b A G 11: 120,945,768 (GRCm39) I191T possibly damaging Het
Septin4 A G 11: 87,458,061 (GRCm39) H145R possibly damaging Het
Setd1b T C 5: 123,285,676 (GRCm39) S241P unknown Het
Slco1a8 T C 6: 141,949,149 (GRCm39) M76V possibly damaging Het
Srpk2 T C 5: 23,729,148 (GRCm39) K497R probably benign Het
Sspo T C 6: 48,467,940 (GRCm39) S4296P probably damaging Het
Syne4 T C 7: 30,016,308 (GRCm39) V168A probably benign Het
Tank T C 2: 61,480,256 (GRCm39) F264S probably damaging Het
Ticrr T C 7: 79,344,955 (GRCm39) S1607P probably damaging Het
Trim30a A G 7: 104,060,405 (GRCm39) V457A probably damaging Het
Trim43b T A 9: 88,967,624 (GRCm39) K336N probably damaging Het
Trim47 T C 11: 115,996,963 (GRCm39) Q598R probably damaging Het
Tspan12 T C 6: 21,851,022 (GRCm39) N18S probably damaging Het
Ubap2 A G 4: 41,221,607 (GRCm39) S231P probably benign Het
Vit A G 17: 78,930,175 (GRCm39) D380G probably damaging Het
Vmn2r2 T C 3: 64,041,942 (GRCm39) N258D possibly damaging Het
Vmn2r52 C T 7: 9,907,333 (GRCm39) C131Y possibly damaging Het
Zfp58 A T 13: 67,639,307 (GRCm39) F395I probably damaging Het
Zfp940 C A 7: 29,544,435 (GRCm39) G491C probably damaging Het
Other mutations in Mprip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mprip APN 11 59,639,417 (GRCm39) missense probably benign 0.07
IGL00563:Mprip APN 11 59,643,443 (GRCm39) missense probably damaging 1.00
IGL00905:Mprip APN 11 59,662,994 (GRCm39) missense possibly damaging 0.79
IGL00928:Mprip APN 11 59,635,578 (GRCm39) missense probably damaging 1.00
IGL01161:Mprip APN 11 59,622,399 (GRCm39) missense possibly damaging 0.93
IGL01991:Mprip APN 11 59,645,838 (GRCm39) missense probably damaging 0.99
IGL02491:Mprip APN 11 59,660,857 (GRCm39) missense probably benign 0.13
IGL03030:Mprip APN 11 59,631,941 (GRCm39) splice site probably null
IGL03056:Mprip APN 11 59,662,518 (GRCm39) missense probably damaging 1.00
IGL03293:Mprip APN 11 59,586,989 (GRCm39) missense probably damaging 1.00
R0049:Mprip UTSW 11 59,657,571 (GRCm39) missense probably damaging 0.99
R0097:Mprip UTSW 11 59,649,317 (GRCm39) missense possibly damaging 0.90
R0097:Mprip UTSW 11 59,649,317 (GRCm39) missense possibly damaging 0.90
R0147:Mprip UTSW 11 59,627,899 (GRCm39) missense possibly damaging 0.68
R0319:Mprip UTSW 11 59,587,864 (GRCm39) splice site probably benign
R0471:Mprip UTSW 11 59,650,561 (GRCm39) missense probably damaging 1.00
R0539:Mprip UTSW 11 59,631,943 (GRCm39) splice site probably benign
R0627:Mprip UTSW 11 59,660,798 (GRCm39) missense probably damaging 1.00
R0864:Mprip UTSW 11 59,649,587 (GRCm39) missense probably benign
R1218:Mprip UTSW 11 59,634,640 (GRCm39) missense probably damaging 1.00
R1469:Mprip UTSW 11 59,650,016 (GRCm39) missense probably damaging 1.00
R1469:Mprip UTSW 11 59,650,016 (GRCm39) missense probably damaging 1.00
R1695:Mprip UTSW 11 59,643,357 (GRCm39) missense probably damaging 0.99
R1698:Mprip UTSW 11 59,651,084 (GRCm39) missense possibly damaging 0.75
R1802:Mprip UTSW 11 59,645,867 (GRCm39) missense probably damaging 1.00
R1837:Mprip UTSW 11 59,657,571 (GRCm39) missense probably damaging 0.99
R2094:Mprip UTSW 11 59,640,334 (GRCm39) splice site probably benign
R2107:Mprip UTSW 11 59,660,717 (GRCm39) missense probably damaging 1.00
R2108:Mprip UTSW 11 59,660,717 (GRCm39) missense probably damaging 1.00
R2510:Mprip UTSW 11 59,640,334 (GRCm39) splice site probably benign
R3003:Mprip UTSW 11 59,618,381 (GRCm39) missense possibly damaging 0.95
R3115:Mprip UTSW 11 59,656,229 (GRCm39) splice site probably null
R3941:Mprip UTSW 11 59,622,328 (GRCm39) splice site probably benign
R4347:Mprip UTSW 11 59,650,279 (GRCm39) missense possibly damaging 0.86
R4603:Mprip UTSW 11 59,622,399 (GRCm39) missense probably damaging 1.00
R4807:Mprip UTSW 11 59,648,846 (GRCm39) missense probably benign 0.00
R5011:Mprip UTSW 11 59,650,721 (GRCm39) missense possibly damaging 0.75
R5338:Mprip UTSW 11 59,651,399 (GRCm39) missense probably damaging 1.00
R5549:Mprip UTSW 11 59,651,644 (GRCm39) missense probably benign 0.00
R5569:Mprip UTSW 11 59,651,789 (GRCm39) missense probably damaging 1.00
R5604:Mprip UTSW 11 59,649,293 (GRCm39) missense probably benign
R5615:Mprip UTSW 11 59,649,313 (GRCm39) missense probably benign 0.08
R5846:Mprip UTSW 11 59,649,380 (GRCm39) missense probably damaging 1.00
R5970:Mprip UTSW 11 59,648,547 (GRCm39) missense probably damaging 0.96
R6054:Mprip UTSW 11 59,649,251 (GRCm39) missense probably benign
R6452:Mprip UTSW 11 59,643,609 (GRCm39) missense probably damaging 1.00
R6457:Mprip UTSW 11 59,649,815 (GRCm39) missense possibly damaging 0.69
R6544:Mprip UTSW 11 59,648,552 (GRCm39) missense probably benign 0.15
R6750:Mprip UTSW 11 59,586,957 (GRCm39) missense probably damaging 1.00
R6843:Mprip UTSW 11 59,650,554 (GRCm39) missense possibly damaging 0.54
R6851:Mprip UTSW 11 59,649,841 (GRCm39) missense probably damaging 0.99
R6867:Mprip UTSW 11 59,640,456 (GRCm39) critical splice donor site probably null
R7002:Mprip UTSW 11 59,652,016 (GRCm39) missense probably benign 0.22
R7023:Mprip UTSW 11 59,628,215 (GRCm39) missense probably damaging 1.00
R7764:Mprip UTSW 11 59,655,242 (GRCm39) missense probably damaging 0.99
R7765:Mprip UTSW 11 59,649,047 (GRCm39) missense possibly damaging 0.90
R7828:Mprip UTSW 11 59,627,915 (GRCm39) missense probably damaging 1.00
R7866:Mprip UTSW 11 59,643,756 (GRCm39) missense possibly damaging 0.60
R7911:Mprip UTSW 11 59,651,681 (GRCm39) missense
R7979:Mprip UTSW 11 59,657,682 (GRCm39) missense probably damaging 1.00
R8292:Mprip UTSW 11 59,650,340 (GRCm39) missense probably benign 0.21
R8481:Mprip UTSW 11 59,648,982 (GRCm39) nonsense probably null
R8717:Mprip UTSW 11 59,650,526 (GRCm39) missense probably benign
R8810:Mprip UTSW 11 59,587,851 (GRCm39) critical splice donor site probably benign
R8981:Mprip UTSW 11 59,622,383 (GRCm39) missense probably damaging 1.00
R9214:Mprip UTSW 11 59,650,901 (GRCm39) missense possibly damaging 0.69
R9245:Mprip UTSW 11 59,628,403 (GRCm39) missense possibly damaging 0.68
R9748:Mprip UTSW 11 59,656,348 (GRCm39) missense probably damaging 1.00
Z1176:Mprip UTSW 11 59,650,310 (GRCm39) missense probably benign 0.05
Z1176:Mprip UTSW 11 59,628,230 (GRCm39) missense possibly damaging 0.83
Z1177:Mprip UTSW 11 59,648,463 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATGCATTGCTGAGCTCAG -3'
(R):5'- CAGCTTCTCTTGGAGCTCAG -3'

Sequencing Primer
(F):5'- GTACCAGTGAGCAAGCCCAG -3'
(R):5'- TTGGAGCTCAGCCACATCC -3'
Posted On 2014-06-23