Mutagenetix > Incidental Mutation

Incidental Mutation 'R1862:Mprip'

204050

Institutional Source

Beutler Lab

Gene Symbol

Mprip

Ensembl Gene

ENSMUSG00000005417

Gene Name

myosin phosphatase Rho interacting protein

Synonyms

p116Rip, Rhoip3, RIP3, p116 Rho interacting protein

MMRRC Submission

039885-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.674) question?

Stock #

R1862 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

59661305-59780860 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 59758221 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 917 (T917M)

Ref Sequence

ENSEMBL: ENSMUSP00000071081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066330] [ENSMUST00000072031] [ENSMUST00000108751] [ENSMUST00000116371] [ENSMUST00000133861]

AlphaFold

P97434

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066330
AA Change: T917M

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000071081
Gene: ENSMUSG00000005417
AA Change: T917M

Domain	Start	End	E-Value	Type
PH	44	152	3.33e-10	SMART
low complexity region	179	190	N/A	INTRINSIC
low complexity region	221	234	N/A	INTRINSIC
Blast:PH	249	320	1e-10	BLAST
PH	351	448	3.76e-18	SMART
low complexity region	492	501	N/A	INTRINSIC
low complexity region	536	555	N/A	INTRINSIC
coiled coil region	636	671	N/A	INTRINSIC
Blast:PAC	806	848	2e-10	BLAST
low complexity region	1005	1023	N/A	INTRINSIC
low complexity region	1047	1059	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1183	1200	N/A	INTRINSIC
coiled coil region	1267	1300	N/A	INTRINSIC
coiled coil region	1617	1642	N/A	INTRINSIC
coiled coil region	1729	1779	N/A	INTRINSIC
coiled coil region	1899	1936	N/A	INTRINSIC
coiled coil region	1960	2110	N/A	INTRINSIC
coiled coil region	2132	2206	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000072031

SMART Domains

Protein: ENSMUSP00000071914
Gene: ENSMUSG00000005417

Domain	Start	End	E-Value	Type
PH	44	152	3.33e-10	SMART
low complexity region	179	190	N/A	INTRINSIC
low complexity region	221	234	N/A	INTRINSIC
Blast:PH	254	320	1e-10	BLAST
PH	387	484	3.76e-18	SMART
low complexity region	528	537	N/A	INTRINSIC
low complexity region	572	591	N/A	INTRINSIC
coiled coil region	672	707	N/A	INTRINSIC
coiled coil region	728	878	N/A	INTRINSIC
coiled coil region	900	974	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108751

SMART Domains

Protein: ENSMUSP00000104382
Gene: ENSMUSG00000005417

Domain	Start	End	E-Value	Type
PH	44	152	3.33e-10	SMART
low complexity region	183	196	N/A	INTRINSIC
Blast:PH	216	282	1e-10	BLAST
PH	349	446	3.76e-18	SMART
low complexity region	490	499	N/A	INTRINSIC
low complexity region	534	553	N/A	INTRINSIC
coiled coil region	634	669	N/A	INTRINSIC
coiled coil region	690	840	N/A	INTRINSIC
coiled coil region	862	936	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000116371

SMART Domains

Protein: ENSMUSP00000112072
Gene: ENSMUSG00000005417

Domain	Start	End	E-Value	Type
PH	44	152	3.33e-10	SMART
low complexity region	179	190	N/A	INTRINSIC
low complexity region	221	234	N/A	INTRINSIC
Blast:PH	254	320	1e-10	BLAST
PH	387	484	3.76e-18	SMART
low complexity region	528	537	N/A	INTRINSIC
low complexity region	572	591	N/A	INTRINSIC
coiled coil region	672	707	N/A	INTRINSIC
coiled coil region	728	878	N/A	INTRINSIC
coiled coil region	900	974	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000132620

SMART Domains

Protein: ENSMUSP00000119422
Gene: ENSMUSG00000005417

Domain	Start	End	E-Value	Type
low complexity region	26	37	N/A	INTRINSIC
low complexity region	68	81	N/A	INTRINSIC
Blast:PH	101	167	9e-11	BLAST
PH	198	295	3.76e-18	SMART
low complexity region	339	348	N/A	INTRINSIC
low complexity region	383	402	N/A	INTRINSIC
coiled coil region	482	517	N/A	INTRINSIC
coiled coil region	538	688	N/A	INTRINSIC
coiled coil region	710	784	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133861

SMART Domains

Protein: ENSMUSP00000119562
Gene: ENSMUSG00000005417

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
low complexity region	47	58	N/A	INTRINSIC
low complexity region	89	102	N/A	INTRINSIC
low complexity region	152	162	N/A	INTRINSIC
low complexity region	259	269	N/A	INTRINSIC
PH	373	470	3.76e-18	SMART
low complexity region	514	523	N/A	INTRINSIC
low complexity region	558	577	N/A	INTRINSIC
coiled coil region	658	693	N/A	INTRINSIC
coiled coil region	714	864	N/A	INTRINSIC
coiled coil region	886	960	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000156111

SMART Domains

Protein: ENSMUSP00000114446
Gene: ENSMUSG00000005417

Domain	Start	End	E-Value	Type
internal_repeat_1	5	38	1.61e-7	PROSPERO
internal_repeat_2	9	51	2.4e-6	PROSPERO
internal_repeat_1	59	92	1.61e-7	PROSPERO
internal_repeat_2	85	129	2.4e-6	PROSPERO
coiled coil region	140	177	N/A	INTRINSIC
coiled coil region	201	351	N/A	INTRINSIC
coiled coil region	373	447	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.9%
20x: 90.5%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox2	T	A	14: 8,241,416	E565D	probably benign	Het
Adam30	A	T	3: 98,162,113	K421*	probably null	Het
Atp6v1b1	A	G	6: 83,749,852		probably null	Het
Cacna1a	A	T	8: 84,415,930	I96F	possibly damaging	Het
Card10	G	A	15: 78,780,514	R747W	probably damaging	Het
Cdh8	T	A	8: 99,190,394	D363V	probably damaging	Het
Cecr2	T	C	6: 120,757,941	Y685H	probably damaging	Het
Cmklr1	T	C	5: 113,614,407	T178A	probably damaging	Het
Col16a1	G	A	4: 130,092,782		probably null	Het
Col4a1	C	T	8: 11,226,439		probably benign	Het
Coro2a	T	A	4: 46,548,797	I166F	possibly damaging	Het
Cry2	T	C	2: 92,424,566	H148R	probably damaging	Het
Crygd	T	C	1: 65,061,974	Y154C	probably benign	Het
Cubn	T	C	2: 13,308,561	Y3066C	probably damaging	Het
Defb15	C	T	8: 21,929,986	E42K	possibly damaging	Het
Dnah12	A	G	14: 26,697,398	D147G	probably benign	Het
Dnah12	A	T	14: 26,709,257	Y340F	probably benign	Het
Dot1l	G	T	10: 80,783,539	R193L	probably damaging	Het
Dupd1	A	G	14: 21,686,689	V115A	probably benign	Het
Esd	A	C	14: 74,742,074	Y119S	probably damaging	Het
Esp36	A	G	17: 38,419,439		probably benign	Het
Etfbkmt	T	A	6: 149,144,151	M1K	probably null	Het
Exph5	A	G	9: 53,376,248	H1543R	probably benign	Het
Fam92a	C	T	4: 12,155,717	V306I	possibly damaging	Het
Fbxo16	A	G	14: 65,270,803	T23A	probably damaging	Het
Gm11492	A	G	11: 87,567,235	H145R	possibly damaging	Het
Gm6614	T	C	6: 142,003,423	M76V	possibly damaging	Het
Gorasp2	C	A	2: 70,679,464	H136Q	probably damaging	Het
Hdc	T	A	2: 126,597,933	I367F	probably benign	Het
Hmcn1	C	T	1: 150,638,900	V3574M	probably benign	Het
Ilvbl	A	G	10: 78,584,124	D592G	probably benign	Het
Inmt	G	A	6: 55,174,883	A34V	probably damaging	Het
Ints9	A	C	14: 65,026,413	H378P	probably benign	Het
Kcnh7	T	A	2: 62,787,754	I464L	possibly damaging	Het
Kcnt2	T	A	1: 140,425,330	V259D	probably damaging	Het
Lipo1	A	G	19: 33,784,692	F135S	probably damaging	Het
Lrba	T	C	3: 86,773,203		probably null	Het
Mapk1	T	A	16: 17,026,429	S22T	probably benign	Het
Mbd3l2	T	C	9: 18,444,921	S181P	possibly damaging	Het
Mgat5	C	T	1: 127,459,969	P554L	probably damaging	Het
Mki67	T	C	7: 135,699,361	T1315A	probably benign	Het
Mroh3	T	A	1: 136,185,988	I688F	probably benign	Het
Myo1d	A	T	11: 80,663,048	Y536N	probably damaging	Het
Neb	C	T	2: 52,162,187		probably null	Het
Noc2l	A	G	4: 156,237,708	R161G	probably benign	Het
Nup54	T	A	5: 92,419,567	I375L	possibly damaging	Het
Nup93	T	C	8: 94,306,102	F539L	probably damaging	Het
Olfr138	A	G	17: 38,275,344	E191G	probably damaging	Het
Olfr417	T	A	1: 174,369,452	H178Q	probably damaging	Het
Olfr480	A	C	7: 108,066,725	Y24*	probably null	Het
Olfr874	T	A	9: 37,746,968	M278K	probably benign	Het
Panx1	A	T	9: 15,007,428	D378E	probably damaging	Het
Papss1	T	A	3: 131,583,184	V170D	possibly damaging	Het
Pcnx	T	C	12: 81,918,732	S558P	probably damaging	Het
Pde3a	T	A	6: 141,250,353	I255N	probably damaging	Het
Pde3a	G	T	6: 141,487,513	A757S	probably damaging	Het
Pdzph1	A	G	17: 58,922,583	Y1027H	probably damaging	Het
Pkhd1	G	T	1: 20,551,020	R805S	probably benign	Het
Polr1a	G	A	6: 71,909,203	G14D	probably damaging	Het
Prg4	T	A	1: 150,460,669	D60V	probably damaging	Het
Ptprc	T	C	1: 138,112,227	S311G	probably benign	Het
Rapgefl1	G	A	11: 98,842,209	R205K	probably benign	Het
Rcan2	A	T	17: 44,037,089		probably null	Het
Rock1	A	G	18: 10,079,207	I1087T	probably damaging	Het
Sectm1b	A	G	11: 121,054,942	I191T	possibly damaging	Het
Setd1b	T	C	5: 123,147,613	S241P	unknown	Het
Srpk2	T	C	5: 23,524,150	K497R	probably benign	Het
Sspo	T	C	6: 48,491,006	S4296P	probably damaging	Het
Syne4	T	C	7: 30,316,883	V168A	probably benign	Het
Tank	T	C	2: 61,649,912	F264S	probably damaging	Het
Ticrr	T	C	7: 79,695,207	S1607P	probably damaging	Het
Trim30a	A	G	7: 104,411,198	V457A	probably damaging	Het
Trim43b	T	A	9: 89,085,571	K336N	probably damaging	Het
Trim47	T	C	11: 116,106,137	Q598R	probably damaging	Het
Tspan12	T	C	6: 21,851,023	N18S	probably damaging	Het
Ubap2	A	G	4: 41,221,607	S231P	probably benign	Het
Vit	A	G	17: 78,622,746	D380G	probably damaging	Het
Vmn2r2	T	C	3: 64,134,521	N258D	possibly damaging	Het
Vmn2r52	C	T	7: 10,173,406	C131Y	possibly damaging	Het
Zadh2	T	C	18: 84,095,318	V373A	possibly damaging	Het
Zfp58	A	T	13: 67,491,188	F395I	probably damaging	Het
Zfp940	C	A	7: 29,845,010	G491C	probably damaging	Het

Other mutations in Mprip

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Mprip	APN	11	59748591	missense	probably benign	0.07
IGL00563:Mprip	APN	11	59752617	missense	probably damaging	1.00
IGL00905:Mprip	APN	11	59772168	missense	possibly damaging	0.79
IGL00928:Mprip	APN	11	59744752	missense	probably damaging	1.00
IGL01161:Mprip	APN	11	59731573	missense	possibly damaging	0.93
IGL01991:Mprip	APN	11	59755012	missense	probably damaging	0.99
IGL02491:Mprip	APN	11	59770031	missense	probably benign	0.13
IGL03030:Mprip	APN	11	59741115	splice site	probably null
IGL03056:Mprip	APN	11	59771692	missense	probably damaging	1.00
IGL03293:Mprip	APN	11	59696163	missense	probably damaging	1.00
R0049:Mprip	UTSW	11	59766745	missense	probably damaging	0.99
R0097:Mprip	UTSW	11	59758491	missense	possibly damaging	0.90
R0097:Mprip	UTSW	11	59758491	missense	possibly damaging	0.90
R0147:Mprip	UTSW	11	59737073	missense	possibly damaging	0.68
R0319:Mprip	UTSW	11	59697038	splice site	probably benign
R0471:Mprip	UTSW	11	59759735	missense	probably damaging	1.00
R0539:Mprip	UTSW	11	59741117	splice site	probably benign
R0627:Mprip	UTSW	11	59769972	missense	probably damaging	1.00
R0864:Mprip	UTSW	11	59758761	missense	probably benign
R1218:Mprip	UTSW	11	59743814	missense	probably damaging	1.00
R1469:Mprip	UTSW	11	59759190	missense	probably damaging	1.00
R1469:Mprip	UTSW	11	59759190	missense	probably damaging	1.00
R1695:Mprip	UTSW	11	59752531	missense	probably damaging	0.99
R1698:Mprip	UTSW	11	59760258	missense	possibly damaging	0.75
R1802:Mprip	UTSW	11	59755041	missense	probably damaging	1.00
R1837:Mprip	UTSW	11	59766745	missense	probably damaging	0.99
R2094:Mprip	UTSW	11	59749508	splice site	probably benign
R2107:Mprip	UTSW	11	59769891	missense	probably damaging	1.00
R2108:Mprip	UTSW	11	59769891	missense	probably damaging	1.00
R2510:Mprip	UTSW	11	59749508	splice site	probably benign
R3003:Mprip	UTSW	11	59727555	missense	possibly damaging	0.95
R3115:Mprip	UTSW	11	59765403	splice site	probably null
R3941:Mprip	UTSW	11	59731502	splice site	probably benign
R4347:Mprip	UTSW	11	59759453	missense	possibly damaging	0.86
R4603:Mprip	UTSW	11	59731573	missense	probably damaging	1.00
R4807:Mprip	UTSW	11	59758020	missense	probably benign	0.00
R5011:Mprip	UTSW	11	59759895	missense	possibly damaging	0.75
R5338:Mprip	UTSW	11	59760573	missense	probably damaging	1.00
R5549:Mprip	UTSW	11	59760818	missense	probably benign	0.00
R5569:Mprip	UTSW	11	59760963	missense	probably damaging	1.00
R5604:Mprip	UTSW	11	59758467	missense	probably benign
R5615:Mprip	UTSW	11	59758487	missense	probably benign	0.08
R5846:Mprip	UTSW	11	59758554	missense	probably damaging	1.00
R5970:Mprip	UTSW	11	59757721	missense	probably damaging	0.96
R6054:Mprip	UTSW	11	59758425	missense	probably benign
R6452:Mprip	UTSW	11	59752783	missense	probably damaging	1.00
R6457:Mprip	UTSW	11	59758989	missense	possibly damaging	0.69
R6544:Mprip	UTSW	11	59757726	missense	probably benign	0.15
R6750:Mprip	UTSW	11	59696131	missense	probably damaging	1.00
R6843:Mprip	UTSW	11	59759728	missense	possibly damaging	0.54
R6851:Mprip	UTSW	11	59759015	missense	probably damaging	0.99
R6867:Mprip	UTSW	11	59749630	critical splice donor site	probably null
R7002:Mprip	UTSW	11	59761190	missense	probably benign	0.22
R7023:Mprip	UTSW	11	59737389	missense	probably damaging	1.00
R7764:Mprip	UTSW	11	59764416	missense	probably damaging	0.99
R7765:Mprip	UTSW	11	59758221	missense	possibly damaging	0.90
R7828:Mprip	UTSW	11	59737089	missense	probably damaging	1.00
R7866:Mprip	UTSW	11	59752930	missense	possibly damaging	0.60
R7911:Mprip	UTSW	11	59760855	missense
R7979:Mprip	UTSW	11	59766856	missense	probably damaging	1.00
R8292:Mprip	UTSW	11	59759514	missense	probably benign	0.21
R8481:Mprip	UTSW	11	59758156	nonsense	probably null
R8717:Mprip	UTSW	11	59759700	missense	probably benign
R8810:Mprip	UTSW	11	59697025	critical splice donor site	probably benign
R8981:Mprip	UTSW	11	59731557	missense	probably damaging	1.00
R9214:Mprip	UTSW	11	59760075	missense	possibly damaging	0.69
R9245:Mprip	UTSW	11	59737577	missense	possibly damaging	0.68
R9748:Mprip	UTSW	11	59765522	missense	probably damaging	1.00
Z1176:Mprip	UTSW	11	59737404	missense	possibly damaging	0.83
Z1176:Mprip	UTSW	11	59759484	missense	probably benign	0.05
Z1177:Mprip	UTSW	11	59757637	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAATGCATTGCTGAGCTCAG -3'
(R):5'- CAGCTTCTCTTGGAGCTCAG -3'

Sequencing Primer
(F):5'- GTACCAGTGAGCAAGCCCAG -3'
(R):5'- TTGGAGCTCAGCCACATCC -3'

Posted On

2014-06-23