Incidental Mutation 'R1862:Myo1d'
ID 204051
Institutional Source Beutler Lab
Gene Symbol Myo1d
Ensembl Gene ENSMUSG00000035441
Gene Name myosin ID
Synonyms D11Ertd9e, 9930104H07Rik
MMRRC Submission 039885-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1862 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 80372952-80670851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 80553874 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 536 (Y536N)
Ref Sequence ENSEMBL: ENSMUSP00000066948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041065] [ENSMUST00000070997]
AlphaFold Q5SYD0
Predicted Effect probably damaging
Transcript: ENSMUST00000041065
AA Change: Y536N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037819
Gene: ENSMUSG00000035441
AA Change: Y536N

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 803 1006 4.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070997
AA Change: Y536N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066948
Gene: ENSMUSG00000035441
AA Change: Y536N

DomainStartEndE-ValueType
MYSc 3 696 N/A SMART
IQ 697 719 1.46e-3 SMART
Pfam:Myosin_TH1 802 913 1.8e-26 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 (GRCm38) E565D probably benign Het
Adam30 A T 3: 98,069,429 (GRCm39) K421* probably null Het
Atp6v1b1 A G 6: 83,726,834 (GRCm39) probably null Het
Cacna1a A T 8: 85,142,559 (GRCm39) I96F possibly damaging Het
Card10 G A 15: 78,664,714 (GRCm39) R747W probably damaging Het
Cdh8 T A 8: 99,917,026 (GRCm39) D363V probably damaging Het
Cecr2 T C 6: 120,734,902 (GRCm39) Y685H probably damaging Het
Cibar1 C T 4: 12,155,717 (GRCm39) V306I possibly damaging Het
Cmklr1 T C 5: 113,752,468 (GRCm39) T178A probably damaging Het
Col16a1 G A 4: 129,986,575 (GRCm39) probably null Het
Col4a1 C T 8: 11,276,439 (GRCm39) probably benign Het
Coro2a T A 4: 46,548,797 (GRCm39) I166F possibly damaging Het
Cry2 T C 2: 92,254,911 (GRCm39) H148R probably damaging Het
Crygd T C 1: 65,101,133 (GRCm39) Y154C probably benign Het
Cubn T C 2: 13,313,372 (GRCm39) Y3066C probably damaging Het
Defb15 C T 8: 22,420,002 (GRCm39) E42K possibly damaging Het
Dnah12 A G 14: 26,418,553 (GRCm39) D147G probably benign Het
Dnah12 A T 14: 26,430,412 (GRCm39) Y340F probably benign Het
Dot1l G T 10: 80,619,373 (GRCm39) R193L probably damaging Het
Dusp29 A G 14: 21,736,757 (GRCm39) V115A probably benign Het
Esd A C 14: 74,979,514 (GRCm39) Y119S probably damaging Het
Esp36 A G 17: 38,730,330 (GRCm39) probably benign Het
Etfbkmt T A 6: 149,045,649 (GRCm39) M1K probably null Het
Exph5 A G 9: 53,287,548 (GRCm39) H1543R probably benign Het
Fbxo16 A G 14: 65,508,252 (GRCm39) T23A probably damaging Het
Gorasp2 C A 2: 70,509,808 (GRCm39) H136Q probably damaging Het
Hdc T A 2: 126,439,853 (GRCm39) I367F probably benign Het
Hmcn1 C T 1: 150,514,651 (GRCm39) V3574M probably benign Het
Ilvbl A G 10: 78,419,958 (GRCm39) D592G probably benign Het
Inmt G A 6: 55,151,868 (GRCm39) A34V probably damaging Het
Ints9 A C 14: 65,263,862 (GRCm39) H378P probably benign Het
Kcnh7 T A 2: 62,618,098 (GRCm39) I464L possibly damaging Het
Kcnt2 T A 1: 140,353,068 (GRCm39) V259D probably damaging Het
Lipo3 A G 19: 33,762,092 (GRCm39) F135S probably damaging Het
Lrba T C 3: 86,680,510 (GRCm39) probably null Het
Mapk1 T A 16: 16,844,293 (GRCm39) S22T probably benign Het
Mbd3l2 T C 9: 18,356,217 (GRCm39) S181P possibly damaging Het
Mgat5 C T 1: 127,387,706 (GRCm39) P554L probably damaging Het
Mki67 T C 7: 135,301,090 (GRCm39) T1315A probably benign Het
Mprip C T 11: 59,649,047 (GRCm39) T917M possibly damaging Het
Mroh3 T A 1: 136,113,726 (GRCm39) I688F probably benign Het
Neb C T 2: 52,052,199 (GRCm39) probably null Het
Noc2l A G 4: 156,322,165 (GRCm39) R161G probably benign Het
Nup54 T A 5: 92,567,426 (GRCm39) I375L possibly damaging Het
Nup93 T C 8: 95,032,730 (GRCm39) F539L probably damaging Het
Or10x1 T A 1: 174,197,018 (GRCm39) H178Q probably damaging Het
Or2n1e A G 17: 38,586,235 (GRCm39) E191G probably damaging Het
Or5p57 A C 7: 107,665,932 (GRCm39) Y24* probably null Het
Or8b12 T A 9: 37,658,264 (GRCm39) M278K probably benign Het
Panx1 A T 9: 14,918,724 (GRCm39) D378E probably damaging Het
Papss1 T A 3: 131,288,945 (GRCm39) V170D possibly damaging Het
Pcnx1 T C 12: 81,965,506 (GRCm39) S558P probably damaging Het
Pde3a G T 6: 141,433,239 (GRCm39) A757S probably damaging Het
Pde3a T A 6: 141,196,079 (GRCm39) I255N probably damaging Het
Pdzph1 A G 17: 59,229,578 (GRCm39) Y1027H probably damaging Het
Pkhd1 G T 1: 20,621,244 (GRCm39) R805S probably benign Het
Polr1a G A 6: 71,886,187 (GRCm39) G14D probably damaging Het
Prg4 T A 1: 150,336,420 (GRCm39) D60V probably damaging Het
Ptgr3 T C 18: 84,113,443 (GRCm39) V373A possibly damaging Het
Ptprc T C 1: 138,039,965 (GRCm39) S311G probably benign Het
Rapgefl1 G A 11: 98,733,035 (GRCm39) R205K probably benign Het
Rcan2 A T 17: 44,347,980 (GRCm39) probably null Het
Rock1 A G 18: 10,079,207 (GRCm39) I1087T probably damaging Het
Sectm1b A G 11: 120,945,768 (GRCm39) I191T possibly damaging Het
Septin4 A G 11: 87,458,061 (GRCm39) H145R possibly damaging Het
Setd1b T C 5: 123,285,676 (GRCm39) S241P unknown Het
Slco1a8 T C 6: 141,949,149 (GRCm39) M76V possibly damaging Het
Srpk2 T C 5: 23,729,148 (GRCm39) K497R probably benign Het
Sspo T C 6: 48,467,940 (GRCm39) S4296P probably damaging Het
Syne4 T C 7: 30,016,308 (GRCm39) V168A probably benign Het
Tank T C 2: 61,480,256 (GRCm39) F264S probably damaging Het
Ticrr T C 7: 79,344,955 (GRCm39) S1607P probably damaging Het
Trim30a A G 7: 104,060,405 (GRCm39) V457A probably damaging Het
Trim43b T A 9: 88,967,624 (GRCm39) K336N probably damaging Het
Trim47 T C 11: 115,996,963 (GRCm39) Q598R probably damaging Het
Tspan12 T C 6: 21,851,022 (GRCm39) N18S probably damaging Het
Ubap2 A G 4: 41,221,607 (GRCm39) S231P probably benign Het
Vit A G 17: 78,930,175 (GRCm39) D380G probably damaging Het
Vmn2r2 T C 3: 64,041,942 (GRCm39) N258D possibly damaging Het
Vmn2r52 C T 7: 9,907,333 (GRCm39) C131Y possibly damaging Het
Zfp58 A T 13: 67,639,307 (GRCm39) F395I probably damaging Het
Zfp940 C A 7: 29,544,435 (GRCm39) G491C probably damaging Het
Other mutations in Myo1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Myo1d APN 11 80,492,566 (GRCm39) missense probably benign
IGL01087:Myo1d APN 11 80,573,261 (GRCm39) missense probably damaging 1.00
IGL01326:Myo1d APN 11 80,575,147 (GRCm39) splice site probably benign
IGL01431:Myo1d APN 11 80,565,665 (GRCm39) missense probably damaging 1.00
IGL01595:Myo1d APN 11 80,566,936 (GRCm39) missense probably benign 0.00
IGL01811:Myo1d APN 11 80,583,823 (GRCm39) missense probably damaging 0.96
IGL02301:Myo1d APN 11 80,567,679 (GRCm39) missense probably benign 0.23
IGL02388:Myo1d APN 11 80,528,823 (GRCm39) nonsense probably null
IGL02485:Myo1d APN 11 80,557,407 (GRCm39) missense probably damaging 1.00
IGL03017:Myo1d APN 11 80,492,452 (GRCm39) missense probably benign 0.26
horton UTSW 11 80,565,534 (GRCm39) missense probably damaging 1.00
multifaceted UTSW 11 80,583,898 (GRCm39) missense probably damaging 1.00
whisper UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
whisper2 UTSW 11 80,557,404 (GRCm39) missense probably damaging 1.00
whisper3 UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R0069:Myo1d UTSW 11 80,528,779 (GRCm39) missense probably damaging 1.00
R0069:Myo1d UTSW 11 80,528,779 (GRCm39) missense probably damaging 1.00
R0081:Myo1d UTSW 11 80,448,349 (GRCm39) missense probably benign 0.00
R0096:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0096:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0244:Myo1d UTSW 11 80,565,534 (GRCm39) missense probably damaging 1.00
R0711:Myo1d UTSW 11 80,375,158 (GRCm39) missense probably damaging 0.99
R0746:Myo1d UTSW 11 80,477,705 (GRCm39) missense possibly damaging 0.94
R1084:Myo1d UTSW 11 80,575,221 (GRCm39) missense probably damaging 1.00
R1514:Myo1d UTSW 11 80,576,734 (GRCm39) missense probably damaging 0.97
R1676:Myo1d UTSW 11 80,575,247 (GRCm39) missense probably damaging 1.00
R2497:Myo1d UTSW 11 80,565,647 (GRCm39) missense probably damaging 1.00
R2512:Myo1d UTSW 11 80,670,543 (GRCm39) missense probably benign 0.00
R3425:Myo1d UTSW 11 80,492,464 (GRCm39) missense probably benign
R3429:Myo1d UTSW 11 80,573,236 (GRCm39) missense probably damaging 1.00
R3917:Myo1d UTSW 11 80,557,404 (GRCm39) missense probably damaging 1.00
R3928:Myo1d UTSW 11 80,375,087 (GRCm39) missense probably benign 0.09
R4706:Myo1d UTSW 11 80,557,467 (GRCm39) missense probably damaging 0.96
R4723:Myo1d UTSW 11 80,670,667 (GRCm39) utr 5 prime probably benign
R4924:Myo1d UTSW 11 80,565,504 (GRCm39) missense probably damaging 1.00
R5042:Myo1d UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R5320:Myo1d UTSW 11 80,575,149 (GRCm39) critical splice donor site probably null
R5481:Myo1d UTSW 11 80,553,921 (GRCm39) missense possibly damaging 0.79
R6214:Myo1d UTSW 11 80,670,617 (GRCm39) start codon destroyed probably null 0.98
R6235:Myo1d UTSW 11 80,583,770 (GRCm39) missense probably benign 0.23
R6282:Myo1d UTSW 11 80,448,338 (GRCm39) missense probably damaging 0.99
R6468:Myo1d UTSW 11 80,448,300 (GRCm39) missense probably benign 0.00
R6668:Myo1d UTSW 11 80,474,701 (GRCm39) intron probably benign
R6954:Myo1d UTSW 11 80,565,783 (GRCm39) missense probably benign 0.21
R7077:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7078:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7080:Myo1d UTSW 11 80,565,460 (GRCm39) missense probably damaging 1.00
R7172:Myo1d UTSW 11 80,483,621 (GRCm39) missense probably benign 0.16
R7276:Myo1d UTSW 11 80,583,898 (GRCm39) missense probably damaging 1.00
R7467:Myo1d UTSW 11 80,477,743 (GRCm39) missense probably damaging 1.00
R7650:Myo1d UTSW 11 80,492,510 (GRCm39) missense probably benign
R7678:Myo1d UTSW 11 80,567,719 (GRCm39) missense possibly damaging 0.80
R7859:Myo1d UTSW 11 80,575,203 (GRCm39) missense probably damaging 1.00
R8324:Myo1d UTSW 11 80,448,347 (GRCm39) missense probably damaging 1.00
R8329:Myo1d UTSW 11 80,528,900 (GRCm39) missense probably benign 0.21
R8474:Myo1d UTSW 11 80,561,745 (GRCm39) missense possibly damaging 0.93
R8799:Myo1d UTSW 11 80,575,205 (GRCm39) missense probably damaging 1.00
R8810:Myo1d UTSW 11 80,567,758 (GRCm39) missense probably benign 0.30
R8810:Myo1d UTSW 11 80,565,758 (GRCm39) missense probably damaging 1.00
R8823:Myo1d UTSW 11 80,492,571 (GRCm39) missense possibly damaging 0.91
R9221:Myo1d UTSW 11 80,565,744 (GRCm39) missense probably damaging 1.00
R9494:Myo1d UTSW 11 80,375,093 (GRCm39) missense probably benign 0.02
R9625:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
R9626:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
R9628:Myo1d UTSW 11 80,448,296 (GRCm39) missense possibly damaging 0.95
Z1088:Myo1d UTSW 11 80,565,724 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGGTATTAGTAGCTCCTGCC -3'
(R):5'- TTTACCTCAGAGCTAAGTGAACTGG -3'

Sequencing Primer
(F):5'- GGTATTAGTAGCTCCTGCCCCAAG -3'
(R):5'- CTCAGAGCTAAGTGAACTGGTTGTAC -3'
Posted On 2014-06-23