Incidental Mutation 'R1862:Rapgefl1'
ID 204054
Institutional Source Beutler Lab
Gene Symbol Rapgefl1
Ensembl Gene ENSMUSG00000038020
Gene Name Rap guanine nucleotide exchange factor (GEF)-like 1
Synonyms
MMRRC Submission 039885-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R1862 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 98727611-98744519 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 98733035 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Lysine at position 205 (R205K)
Ref Sequence ENSEMBL: ENSMUSP00000103103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107479]
AlphaFold Q68EF8
Predicted Effect noncoding transcript
Transcript: ENSMUST00000037640
Predicted Effect probably benign
Transcript: ENSMUST00000107479
AA Change: R205K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103103
Gene: ENSMUSG00000038020
AA Change: R205K

DomainStartEndE-ValueType
low complexity region 22 49 N/A INTRINSIC
low complexity region 50 65 N/A INTRINSIC
low complexity region 70 100 N/A INTRINSIC
low complexity region 108 133 N/A INTRINSIC
low complexity region 169 180 N/A INTRINSIC
RasGEF 420 661 2.39e-84 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 (GRCm38) E565D probably benign Het
Adam30 A T 3: 98,069,429 (GRCm39) K421* probably null Het
Atp6v1b1 A G 6: 83,726,834 (GRCm39) probably null Het
Cacna1a A T 8: 85,142,559 (GRCm39) I96F possibly damaging Het
Card10 G A 15: 78,664,714 (GRCm39) R747W probably damaging Het
Cdh8 T A 8: 99,917,026 (GRCm39) D363V probably damaging Het
Cecr2 T C 6: 120,734,902 (GRCm39) Y685H probably damaging Het
Cibar1 C T 4: 12,155,717 (GRCm39) V306I possibly damaging Het
Cmklr1 T C 5: 113,752,468 (GRCm39) T178A probably damaging Het
Col16a1 G A 4: 129,986,575 (GRCm39) probably null Het
Col4a1 C T 8: 11,276,439 (GRCm39) probably benign Het
Coro2a T A 4: 46,548,797 (GRCm39) I166F possibly damaging Het
Cry2 T C 2: 92,254,911 (GRCm39) H148R probably damaging Het
Crygd T C 1: 65,101,133 (GRCm39) Y154C probably benign Het
Cubn T C 2: 13,313,372 (GRCm39) Y3066C probably damaging Het
Defb15 C T 8: 22,420,002 (GRCm39) E42K possibly damaging Het
Dnah12 A G 14: 26,418,553 (GRCm39) D147G probably benign Het
Dnah12 A T 14: 26,430,412 (GRCm39) Y340F probably benign Het
Dot1l G T 10: 80,619,373 (GRCm39) R193L probably damaging Het
Dusp29 A G 14: 21,736,757 (GRCm39) V115A probably benign Het
Esd A C 14: 74,979,514 (GRCm39) Y119S probably damaging Het
Esp36 A G 17: 38,730,330 (GRCm39) probably benign Het
Etfbkmt T A 6: 149,045,649 (GRCm39) M1K probably null Het
Exph5 A G 9: 53,287,548 (GRCm39) H1543R probably benign Het
Fbxo16 A G 14: 65,508,252 (GRCm39) T23A probably damaging Het
Gorasp2 C A 2: 70,509,808 (GRCm39) H136Q probably damaging Het
Hdc T A 2: 126,439,853 (GRCm39) I367F probably benign Het
Hmcn1 C T 1: 150,514,651 (GRCm39) V3574M probably benign Het
Ilvbl A G 10: 78,419,958 (GRCm39) D592G probably benign Het
Inmt G A 6: 55,151,868 (GRCm39) A34V probably damaging Het
Ints9 A C 14: 65,263,862 (GRCm39) H378P probably benign Het
Kcnh7 T A 2: 62,618,098 (GRCm39) I464L possibly damaging Het
Kcnt2 T A 1: 140,353,068 (GRCm39) V259D probably damaging Het
Lipo3 A G 19: 33,762,092 (GRCm39) F135S probably damaging Het
Lrba T C 3: 86,680,510 (GRCm39) probably null Het
Mapk1 T A 16: 16,844,293 (GRCm39) S22T probably benign Het
Mbd3l2 T C 9: 18,356,217 (GRCm39) S181P possibly damaging Het
Mgat5 C T 1: 127,387,706 (GRCm39) P554L probably damaging Het
Mki67 T C 7: 135,301,090 (GRCm39) T1315A probably benign Het
Mprip C T 11: 59,649,047 (GRCm39) T917M possibly damaging Het
Mroh3 T A 1: 136,113,726 (GRCm39) I688F probably benign Het
Myo1d A T 11: 80,553,874 (GRCm39) Y536N probably damaging Het
Neb C T 2: 52,052,199 (GRCm39) probably null Het
Noc2l A G 4: 156,322,165 (GRCm39) R161G probably benign Het
Nup54 T A 5: 92,567,426 (GRCm39) I375L possibly damaging Het
Nup93 T C 8: 95,032,730 (GRCm39) F539L probably damaging Het
Or10x1 T A 1: 174,197,018 (GRCm39) H178Q probably damaging Het
Or2n1e A G 17: 38,586,235 (GRCm39) E191G probably damaging Het
Or5p57 A C 7: 107,665,932 (GRCm39) Y24* probably null Het
Or8b12 T A 9: 37,658,264 (GRCm39) M278K probably benign Het
Panx1 A T 9: 14,918,724 (GRCm39) D378E probably damaging Het
Papss1 T A 3: 131,288,945 (GRCm39) V170D possibly damaging Het
Pcnx1 T C 12: 81,965,506 (GRCm39) S558P probably damaging Het
Pde3a G T 6: 141,433,239 (GRCm39) A757S probably damaging Het
Pde3a T A 6: 141,196,079 (GRCm39) I255N probably damaging Het
Pdzph1 A G 17: 59,229,578 (GRCm39) Y1027H probably damaging Het
Pkhd1 G T 1: 20,621,244 (GRCm39) R805S probably benign Het
Polr1a G A 6: 71,886,187 (GRCm39) G14D probably damaging Het
Prg4 T A 1: 150,336,420 (GRCm39) D60V probably damaging Het
Ptgr3 T C 18: 84,113,443 (GRCm39) V373A possibly damaging Het
Ptprc T C 1: 138,039,965 (GRCm39) S311G probably benign Het
Rcan2 A T 17: 44,347,980 (GRCm39) probably null Het
Rock1 A G 18: 10,079,207 (GRCm39) I1087T probably damaging Het
Sectm1b A G 11: 120,945,768 (GRCm39) I191T possibly damaging Het
Septin4 A G 11: 87,458,061 (GRCm39) H145R possibly damaging Het
Setd1b T C 5: 123,285,676 (GRCm39) S241P unknown Het
Slco1a8 T C 6: 141,949,149 (GRCm39) M76V possibly damaging Het
Srpk2 T C 5: 23,729,148 (GRCm39) K497R probably benign Het
Sspo T C 6: 48,467,940 (GRCm39) S4296P probably damaging Het
Syne4 T C 7: 30,016,308 (GRCm39) V168A probably benign Het
Tank T C 2: 61,480,256 (GRCm39) F264S probably damaging Het
Ticrr T C 7: 79,344,955 (GRCm39) S1607P probably damaging Het
Trim30a A G 7: 104,060,405 (GRCm39) V457A probably damaging Het
Trim43b T A 9: 88,967,624 (GRCm39) K336N probably damaging Het
Trim47 T C 11: 115,996,963 (GRCm39) Q598R probably damaging Het
Tspan12 T C 6: 21,851,022 (GRCm39) N18S probably damaging Het
Ubap2 A G 4: 41,221,607 (GRCm39) S231P probably benign Het
Vit A G 17: 78,930,175 (GRCm39) D380G probably damaging Het
Vmn2r2 T C 3: 64,041,942 (GRCm39) N258D possibly damaging Het
Vmn2r52 C T 7: 9,907,333 (GRCm39) C131Y possibly damaging Het
Zfp58 A T 13: 67,639,307 (GRCm39) F395I probably damaging Het
Zfp940 C A 7: 29,544,435 (GRCm39) G491C probably damaging Het
Other mutations in Rapgefl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Rapgefl1 APN 11 98,737,961 (GRCm39) missense probably damaging 1.00
IGL03088:Rapgefl1 APN 11 98,740,058 (GRCm39) missense probably damaging 1.00
IGL03048:Rapgefl1 UTSW 11 98,727,990 (GRCm39) missense possibly damaging 0.96
R1807:Rapgefl1 UTSW 11 98,736,815 (GRCm39) critical splice donor site probably null
R4078:Rapgefl1 UTSW 11 98,740,803 (GRCm39) missense probably benign 0.34
R4079:Rapgefl1 UTSW 11 98,740,803 (GRCm39) missense probably benign 0.34
R4869:Rapgefl1 UTSW 11 98,741,935 (GRCm39) missense probably damaging 1.00
R5994:Rapgefl1 UTSW 11 98,740,986 (GRCm39) missense probably benign 0.06
R6275:Rapgefl1 UTSW 11 98,741,946 (GRCm39) missense probably damaging 1.00
R6930:Rapgefl1 UTSW 11 98,737,947 (GRCm39) missense probably damaging 1.00
R7138:Rapgefl1 UTSW 11 98,737,900 (GRCm39) critical splice acceptor site probably null
R7432:Rapgefl1 UTSW 11 98,741,940 (GRCm39) missense probably damaging 1.00
R7516:Rapgefl1 UTSW 11 98,736,960 (GRCm39) missense probably benign 0.12
R7761:Rapgefl1 UTSW 11 98,728,485 (GRCm39) missense probably benign 0.05
R7775:Rapgefl1 UTSW 11 98,741,980 (GRCm39) missense probably damaging 1.00
R7824:Rapgefl1 UTSW 11 98,741,980 (GRCm39) missense probably damaging 1.00
R8018:Rapgefl1 UTSW 11 98,731,166 (GRCm39) critical splice donor site probably null
R8099:Rapgefl1 UTSW 11 98,738,209 (GRCm39) missense probably damaging 0.98
R8501:Rapgefl1 UTSW 11 98,733,053 (GRCm39) missense possibly damaging 0.94
R8941:Rapgefl1 UTSW 11 98,731,101 (GRCm39) missense probably damaging 1.00
Z1088:Rapgefl1 UTSW 11 98,736,721 (GRCm39) missense probably damaging 0.99
Z1176:Rapgefl1 UTSW 11 98,736,807 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGAATGTGGTGAAGTTGAAGC -3'
(R):5'- AGCTTGAGGAACATGAGTCC -3'

Sequencing Primer
(F):5'- GAAGCTTATTATTTGCATTCTGAGC -3'
(R):5'- AACATGAGTCCTTCATAGGGGCC -3'
Posted On 2014-06-23