Incidental Mutation 'R1862:Acox2'
ID 204059
Institutional Source Beutler Lab
Gene Symbol Acox2
Ensembl Gene ENSMUSG00000021751
Gene Name acyl-Coenzyme A oxidase 2, branched chain
Synonyms
MMRRC Submission 039885-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock # R1862 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 8225511-8259353 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 8241416 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 565 (E565D)
Ref Sequence ENSEMBL: ENSMUSP00000126464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022271] [ENSMUST00000164598]
AlphaFold Q9QXD1
Predicted Effect probably benign
Transcript: ENSMUST00000022271
AA Change: E565D

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022271
Gene: ENSMUSG00000021751
AA Change: E565D

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 1.2e-28 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 492 677 3.2e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116361
Predicted Effect probably benign
Transcript: ENSMUST00000164598
AA Change: E565D

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126464
Gene: ENSMUSG00000021751
AA Change: E565D

DomainStartEndE-ValueType
Pfam:Acyl-CoA_ox_N 32 148 6.3e-29 PFAM
Pfam:Acyl-CoA_dh_M 150 260 2.8e-11 PFAM
SCOP:d1is2a1 309 478 1e-28 SMART
Pfam:ACOX 495 675 1.3e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165169
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the acyl-CoA oxidase family. It encodes the branched-chain acyl-CoA oxidase which is involved in the degradation of long branched fatty acids and bile acid intermediates in peroxisomes. Deficiency of this enzyme results in the accumulation of branched fatty acids and bile acid intermediates, and may lead to Zellweger syndrome, severe mental retardation, and death in children. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice heterozygous for an endonuclease-mediated deletion exhibit no detectable phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam30 A T 3: 98,162,113 K421* probably null Het
Atp6v1b1 A G 6: 83,749,852 probably null Het
Cacna1a A T 8: 84,415,930 I96F possibly damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cdh8 T A 8: 99,190,394 D363V probably damaging Het
Cecr2 T C 6: 120,757,941 Y685H probably damaging Het
Cmklr1 T C 5: 113,614,407 T178A probably damaging Het
Col16a1 G A 4: 130,092,782 probably null Het
Col4a1 C T 8: 11,226,439 probably benign Het
Coro2a T A 4: 46,548,797 I166F possibly damaging Het
Cry2 T C 2: 92,424,566 H148R probably damaging Het
Crygd T C 1: 65,061,974 Y154C probably benign Het
Cubn T C 2: 13,308,561 Y3066C probably damaging Het
Defb15 C T 8: 21,929,986 E42K possibly damaging Het
Dnah12 A G 14: 26,697,398 D147G probably benign Het
Dnah12 A T 14: 26,709,257 Y340F probably benign Het
Dot1l G T 10: 80,783,539 R193L probably damaging Het
Dupd1 A G 14: 21,686,689 V115A probably benign Het
Esd A C 14: 74,742,074 Y119S probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Etfbkmt T A 6: 149,144,151 M1K probably null Het
Exph5 A G 9: 53,376,248 H1543R probably benign Het
Fam92a C T 4: 12,155,717 V306I possibly damaging Het
Fbxo16 A G 14: 65,270,803 T23A probably damaging Het
Gm11492 A G 11: 87,567,235 H145R possibly damaging Het
Gm6614 T C 6: 142,003,423 M76V possibly damaging Het
Gorasp2 C A 2: 70,679,464 H136Q probably damaging Het
Hdc T A 2: 126,597,933 I367F probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ilvbl A G 10: 78,584,124 D592G probably benign Het
Inmt G A 6: 55,174,883 A34V probably damaging Het
Ints9 A C 14: 65,026,413 H378P probably benign Het
Kcnh7 T A 2: 62,787,754 I464L possibly damaging Het
Kcnt2 T A 1: 140,425,330 V259D probably damaging Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrba T C 3: 86,773,203 probably null Het
Mapk1 T A 16: 17,026,429 S22T probably benign Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mgat5 C T 1: 127,459,969 P554L probably damaging Het
Mki67 T C 7: 135,699,361 T1315A probably benign Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Mroh3 T A 1: 136,185,988 I688F probably benign Het
Myo1d A T 11: 80,663,048 Y536N probably damaging Het
Neb C T 2: 52,162,187 probably null Het
Noc2l A G 4: 156,237,708 R161G probably benign Het
Nup54 T A 5: 92,419,567 I375L possibly damaging Het
Nup93 T C 8: 94,306,102 F539L probably damaging Het
Olfr138 A G 17: 38,275,344 E191G probably damaging Het
Olfr417 T A 1: 174,369,452 H178Q probably damaging Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr874 T A 9: 37,746,968 M278K probably benign Het
Panx1 A T 9: 15,007,428 D378E probably damaging Het
Papss1 T A 3: 131,583,184 V170D possibly damaging Het
Pcnx T C 12: 81,918,732 S558P probably damaging Het
Pde3a T A 6: 141,250,353 I255N probably damaging Het
Pde3a G T 6: 141,487,513 A757S probably damaging Het
Pdzph1 A G 17: 58,922,583 Y1027H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Polr1a G A 6: 71,909,203 G14D probably damaging Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Ptprc T C 1: 138,112,227 S311G probably benign Het
Rapgefl1 G A 11: 98,842,209 R205K probably benign Het
Rcan2 A T 17: 44,037,089 probably null Het
Rock1 A G 18: 10,079,207 I1087T probably damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Setd1b T C 5: 123,147,613 S241P unknown Het
Srpk2 T C 5: 23,524,150 K497R probably benign Het
Sspo T C 6: 48,491,006 S4296P probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tank T C 2: 61,649,912 F264S probably damaging Het
Ticrr T C 7: 79,695,207 S1607P probably damaging Het
Trim30a A G 7: 104,411,198 V457A probably damaging Het
Trim43b T A 9: 89,085,571 K336N probably damaging Het
Trim47 T C 11: 116,106,137 Q598R probably damaging Het
Tspan12 T C 6: 21,851,023 N18S probably damaging Het
Ubap2 A G 4: 41,221,607 S231P probably benign Het
Vit A G 17: 78,622,746 D380G probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Vmn2r52 C T 7: 10,173,406 C131Y possibly damaging Het
Zadh2 T C 18: 84,095,318 V373A possibly damaging Het
Zfp58 A T 13: 67,491,188 F395I probably damaging Het
Zfp940 C A 7: 29,845,010 G491C probably damaging Het
Other mutations in Acox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Acox2 APN 14 8246363 missense probably damaging 1.00
IGL01845:Acox2 APN 14 8251617 missense probably damaging 1.00
IGL02830:Acox2 APN 14 8255298 missense probably damaging 1.00
R0415:Acox2 UTSW 14 8243835 splice site probably benign
R0535:Acox2 UTSW 14 8256753 missense probably damaging 1.00
R1424:Acox2 UTSW 14 8230247 missense probably benign 0.02
R1836:Acox2 UTSW 14 8248059 missense possibly damaging 0.91
R1885:Acox2 UTSW 14 8248102 missense probably benign 0.00
R2032:Acox2 UTSW 14 8246400 missense probably benign 0.00
R2268:Acox2 UTSW 14 8253496 missense probably damaging 0.98
R2497:Acox2 UTSW 14 8251612 missense probably benign 0.00
R3032:Acox2 UTSW 14 8253466 missense probably damaging 1.00
R3842:Acox2 UTSW 14 8251543 missense probably damaging 1.00
R3874:Acox2 UTSW 14 8248061 missense probably benign 0.00
R4763:Acox2 UTSW 14 8241334 missense possibly damaging 0.81
R5072:Acox2 UTSW 14 8241374 nonsense probably null
R5397:Acox2 UTSW 14 8243803 missense probably benign 0.02
R5950:Acox2 UTSW 14 8255793 missense probably benign
R7188:Acox2 UTSW 14 8252996 missense possibly damaging 0.67
R7208:Acox2 UTSW 14 8241303 missense probably benign 0.27
R7315:Acox2 UTSW 14 8256139 missense probably damaging 0.99
R7757:Acox2 UTSW 14 8230166 missense probably damaging 1.00
R7888:Acox2 UTSW 14 8246415 missense probably benign 0.00
R8269:Acox2 UTSW 14 8246325 missense probably benign 0.00
R8531:Acox2 UTSW 14 8247960 missense probably damaging 1.00
R8536:Acox2 UTSW 14 8256081 missense probably benign 0.00
R8782:Acox2 UTSW 14 8250035 missense probably damaging 0.99
R8964:Acox2 UTSW 14 8243768 nonsense probably null
R9183:Acox2 UTSW 14 8251559 missense probably damaging 1.00
R9463:Acox2 UTSW 14 8256789 missense probably damaging 1.00
R9466:Acox2 UTSW 14 8248092 missense probably benign 0.12
Z1177:Acox2 UTSW 14 8256852 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCCAAGTTTGCAAGGTCTTGG -3'
(R):5'- TACCACCAGTCCTTGAGGAGAC -3'

Sequencing Primer
(F):5'- CACCAGGGTCTAACATGGTTTCAAG -3'
(R):5'- GTCCTTGAGGAGACACACATACTC -3'
Posted On 2014-06-23