Incidental Mutation 'R1862:Dnah12'
ID 204061
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Name dynein, axonemal, heavy chain 12
Synonyms DHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12
MMRRC Submission 039885-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.184) question?
Stock # R1862 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 26693274-26891703 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26697398 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 147 (D147G)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022433
AA Change: D147G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: D147G

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 E565D probably benign Het
Adam30 A T 3: 98,162,113 K421* probably null Het
Atp6v1b1 A G 6: 83,749,852 probably null Het
Cacna1a A T 8: 84,415,930 I96F possibly damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cdh8 T A 8: 99,190,394 D363V probably damaging Het
Cecr2 T C 6: 120,757,941 Y685H probably damaging Het
Cmklr1 T C 5: 113,614,407 T178A probably damaging Het
Col16a1 G A 4: 130,092,782 probably null Het
Col4a1 C T 8: 11,226,439 probably benign Het
Coro2a T A 4: 46,548,797 I166F possibly damaging Het
Cry2 T C 2: 92,424,566 H148R probably damaging Het
Crygd T C 1: 65,061,974 Y154C probably benign Het
Cubn T C 2: 13,308,561 Y3066C probably damaging Het
Defb15 C T 8: 21,929,986 E42K possibly damaging Het
Dot1l G T 10: 80,783,539 R193L probably damaging Het
Dupd1 A G 14: 21,686,689 V115A probably benign Het
Esd A C 14: 74,742,074 Y119S probably damaging Het
Esp36 A G 17: 38,419,439 probably benign Het
Etfbkmt T A 6: 149,144,151 M1K probably null Het
Exph5 A G 9: 53,376,248 H1543R probably benign Het
Fam92a C T 4: 12,155,717 V306I possibly damaging Het
Fbxo16 A G 14: 65,270,803 T23A probably damaging Het
Gm11492 A G 11: 87,567,235 H145R possibly damaging Het
Gm6614 T C 6: 142,003,423 M76V possibly damaging Het
Gorasp2 C A 2: 70,679,464 H136Q probably damaging Het
Hdc T A 2: 126,597,933 I367F probably benign Het
Hmcn1 C T 1: 150,638,900 V3574M probably benign Het
Ilvbl A G 10: 78,584,124 D592G probably benign Het
Inmt G A 6: 55,174,883 A34V probably damaging Het
Ints9 A C 14: 65,026,413 H378P probably benign Het
Kcnh7 T A 2: 62,787,754 I464L possibly damaging Het
Kcnt2 T A 1: 140,425,330 V259D probably damaging Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrba T C 3: 86,773,203 probably null Het
Mapk1 T A 16: 17,026,429 S22T probably benign Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mgat5 C T 1: 127,459,969 P554L probably damaging Het
Mki67 T C 7: 135,699,361 T1315A probably benign Het
Mprip C T 11: 59,758,221 T917M possibly damaging Het
Mroh3 T A 1: 136,185,988 I688F probably benign Het
Myo1d A T 11: 80,663,048 Y536N probably damaging Het
Neb C T 2: 52,162,187 probably null Het
Noc2l A G 4: 156,237,708 R161G probably benign Het
Nup54 T A 5: 92,419,567 I375L possibly damaging Het
Nup93 T C 8: 94,306,102 F539L probably damaging Het
Olfr138 A G 17: 38,275,344 E191G probably damaging Het
Olfr417 T A 1: 174,369,452 H178Q probably damaging Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr874 T A 9: 37,746,968 M278K probably benign Het
Panx1 A T 9: 15,007,428 D378E probably damaging Het
Papss1 T A 3: 131,583,184 V170D possibly damaging Het
Pcnx T C 12: 81,918,732 S558P probably damaging Het
Pde3a G T 6: 141,487,513 A757S probably damaging Het
Pde3a T A 6: 141,250,353 I255N probably damaging Het
Pdzph1 A G 17: 58,922,583 Y1027H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Polr1a G A 6: 71,909,203 G14D probably damaging Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Ptprc T C 1: 138,112,227 S311G probably benign Het
Rapgefl1 G A 11: 98,842,209 R205K probably benign Het
Rcan2 A T 17: 44,037,089 probably null Het
Rock1 A G 18: 10,079,207 I1087T probably damaging Het
Sectm1b A G 11: 121,054,942 I191T possibly damaging Het
Setd1b T C 5: 123,147,613 S241P unknown Het
Srpk2 T C 5: 23,524,150 K497R probably benign Het
Sspo T C 6: 48,491,006 S4296P probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tank T C 2: 61,649,912 F264S probably damaging Het
Ticrr T C 7: 79,695,207 S1607P probably damaging Het
Trim30a A G 7: 104,411,198 V457A probably damaging Het
Trim43b T A 9: 89,085,571 K336N probably damaging Het
Trim47 T C 11: 116,106,137 Q598R probably damaging Het
Tspan12 T C 6: 21,851,023 N18S probably damaging Het
Ubap2 A G 4: 41,221,607 S231P probably benign Het
Vit A G 17: 78,622,746 D380G probably damaging Het
Vmn2r2 T C 3: 64,134,521 N258D possibly damaging Het
Vmn2r52 C T 7: 10,173,406 C131Y possibly damaging Het
Zadh2 T C 18: 84,095,318 V373A possibly damaging Het
Zfp58 A T 13: 67,491,188 F395I probably damaging Het
Zfp940 C A 7: 29,845,010 G491C probably damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26,771,005 (GRCm38) missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26,710,275 (GRCm38) splice site probably benign
IGL01681:Dnah12 APN 14 26,722,160 (GRCm38) missense probably benign
IGL02082:Dnah12 APN 14 26,707,162 (GRCm38) missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26,716,577 (GRCm38) missense probably benign 0.20
IGL02170:Dnah12 APN 14 26,773,112 (GRCm38) missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26,706,917 (GRCm38) missense probably benign 0.00
IGL02367:Dnah12 APN 14 26,709,161 (GRCm38) missense probably benign 0.30
IGL02418:Dnah12 APN 14 26,773,722 (GRCm38) missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26,724,512 (GRCm38) missense probably benign 0.02
IGL03066:Dnah12 APN 14 26,697,398 (GRCm38) missense probably benign 0.06
drippings UTSW 14 26,854,804 (GRCm38) missense probably damaging 1.00
grueben UTSW 14 26,878,079 (GRCm38) missense probably damaging 1.00
BB010:Dnah12 UTSW 14 26,766,115 (GRCm38) missense probably benign 0.00
BB020:Dnah12 UTSW 14 26,766,115 (GRCm38) missense probably benign 0.00
F5770:Dnah12 UTSW 14 26,773,093 (GRCm38) missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26,849,385 (GRCm38) missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26,849,385 (GRCm38) missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26,849,385 (GRCm38) missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26,849,385 (GRCm38) missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26,872,740 (GRCm38) missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26,849,385 (GRCm38) missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26,772,644 (GRCm38) missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26,798,899 (GRCm38) missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26,799,999 (GRCm38) missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26,706,117 (GRCm38) splice site probably null
R0364:Dnah12 UTSW 14 26,724,473 (GRCm38) missense probably benign 0.10
R0469:Dnah12 UTSW 14 26,798,899 (GRCm38) missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26,709,310 (GRCm38) missense probably benign 0.00
R0709:Dnah12 UTSW 14 26,884,265 (GRCm38) splice site probably benign
R0734:Dnah12 UTSW 14 26,800,013 (GRCm38) missense probably benign 0.00
R1273:Dnah12 UTSW 14 26,739,220 (GRCm38) nonsense probably null
R1496:Dnah12 UTSW 14 26,710,248 (GRCm38) missense probably benign
R1503:Dnah12 UTSW 14 26,773,692 (GRCm38) missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26,816,322 (GRCm38) missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26,766,190 (GRCm38) missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26,778,883 (GRCm38) missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26,766,114 (GRCm38) missense probably benign 0.02
R1826:Dnah12 UTSW 14 26,711,019 (GRCm38) missense probably benign 0.01
R1829:Dnah12 UTSW 14 26,800,075 (GRCm38) missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26,773,023 (GRCm38) missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26,709,257 (GRCm38) missense probably benign 0.30
R1913:Dnah12 UTSW 14 26,792,264 (GRCm38) splice site probably null
R1933:Dnah12 UTSW 14 26,734,495 (GRCm38) missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26,814,459 (GRCm38) missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26,781,528 (GRCm38) missense probably null 1.00
R2113:Dnah12 UTSW 14 26,766,141 (GRCm38) missense probably damaging 1.00
R2125:Dnah12 UTSW 14 26,724,458 (GRCm38) nonsense probably null
R2126:Dnah12 UTSW 14 26,724,458 (GRCm38) nonsense probably null
R2207:Dnah12 UTSW 14 26,781,787 (GRCm38) missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26,739,330 (GRCm38) missense probably benign 0.06
R2511:Dnah12 UTSW 14 26,769,950 (GRCm38) missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26,876,950 (GRCm38) missense probably benign 0.05
R2875:Dnah12 UTSW 14 26,693,470 (GRCm38) missense probably benign 0.04
R3551:Dnah12 UTSW 14 26,770,972 (GRCm38) missense probably benign 0.01
R3713:Dnah12 UTSW 14 26,812,790 (GRCm38) missense probably benign
R3729:Dnah12 UTSW 14 26,706,065 (GRCm38) missense probably benign 0.02
R3799:Dnah12 UTSW 14 26,770,923 (GRCm38) missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26,710,211 (GRCm38) missense probably benign 0.00
R3892:Dnah12 UTSW 14 26,856,616 (GRCm38) missense probably benign 0.03
R3921:Dnah12 UTSW 14 26,771,051 (GRCm38) missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26,723,599 (GRCm38) missense probably benign
R4065:Dnah12 UTSW 14 26,770,448 (GRCm38) missense probably benign 0.02
R4113:Dnah12 UTSW 14 26,693,567 (GRCm38) missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26,709,186 (GRCm38) missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26,798,926 (GRCm38) missense probably benign 0.01
R4260:Dnah12 UTSW 14 26,798,926 (GRCm38) missense probably benign 0.01
R4348:Dnah12 UTSW 14 26,814,541 (GRCm38) missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26,815,507 (GRCm38) missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26,734,603 (GRCm38) missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26,734,603 (GRCm38) missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26,871,855 (GRCm38) missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26,876,958 (GRCm38) missense possibly damaging 0.83
R4523:Dnah12 UTSW 14 26,770,022 (GRCm38) missense probably damaging 0.97
R4546:Dnah12 UTSW 14 26,773,014 (GRCm38) missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26,772,594 (GRCm38) missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26,735,758 (GRCm38) missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26,706,839 (GRCm38) missense probably benign 0.00
R4727:Dnah12 UTSW 14 26,872,317 (GRCm38) missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26,781,784 (GRCm38) missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26,781,784 (GRCm38) missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26,716,629 (GRCm38) nonsense probably null
R4879:Dnah12 UTSW 14 26,718,046 (GRCm38) critical splice donor site probably null
R4893:Dnah12 UTSW 14 26,710,170 (GRCm38) missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26,734,570 (GRCm38) missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26,861,805 (GRCm38) nonsense probably null
R4939:Dnah12 UTSW 14 26,891,524 (GRCm38) missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26,716,700 (GRCm38) missense probably benign 0.00
R5011:Dnah12 UTSW 14 26,710,171 (GRCm38) missense probably benign 0.03
R5013:Dnah12 UTSW 14 26,710,171 (GRCm38) missense probably benign 0.03
R5043:Dnah12 UTSW 14 26,884,190 (GRCm38) missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26,735,697 (GRCm38) missense probably benign 0.09
R5122:Dnah12 UTSW 14 26,718,000 (GRCm38) missense probably benign 0.00
R5135:Dnah12 UTSW 14 26,770,477 (GRCm38) missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26,850,926 (GRCm38) nonsense probably null
R5154:Dnah12 UTSW 14 26,849,363 (GRCm38) missense probably benign 0.12
R5206:Dnah12 UTSW 14 26,769,985 (GRCm38) missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26,693,486 (GRCm38) missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26,773,830 (GRCm38) missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26,879,738 (GRCm38) missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26,814,537 (GRCm38) missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26,774,342 (GRCm38) splice site probably null
R5389:Dnah12 UTSW 14 26,735,749 (GRCm38) missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26,859,299 (GRCm38) missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26,771,050 (GRCm38) missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26,710,269 (GRCm38) missense probably benign 0.01
R5681:Dnah12 UTSW 14 26,815,495 (GRCm38) missense probably benign 0.32
R5824:Dnah12 UTSW 14 26,770,518 (GRCm38) critical splice donor site probably null
R5863:Dnah12 UTSW 14 26,854,921 (GRCm38) missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26,706,884 (GRCm38) missense probably benign 0.09
R5912:Dnah12 UTSW 14 26,770,008 (GRCm38) nonsense probably null
R5916:Dnah12 UTSW 14 26,706,918 (GRCm38) missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26,706,867 (GRCm38) missense probably benign 0.00
R5987:Dnah12 UTSW 14 26,886,871 (GRCm38) missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26,697,341 (GRCm38) missense probably benign 0.04
R6132:Dnah12 UTSW 14 26,717,911 (GRCm38) missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26,875,270 (GRCm38) missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26,773,685 (GRCm38) missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26,861,769 (GRCm38) missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26,710,257 (GRCm38) missense probably benign 0.03
R6235:Dnah12 UTSW 14 26,854,804 (GRCm38) missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26,770,482 (GRCm38) missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26,717,974 (GRCm38) missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26,706,834 (GRCm38) missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26,878,051 (GRCm38) missense probably benign 0.06
R6480:Dnah12 UTSW 14 26,872,455 (GRCm38) missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26,735,710 (GRCm38) missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26,735,692 (GRCm38) missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26,872,749 (GRCm38) missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26,796,223 (GRCm38) missense probably benign 0.02
R6745:Dnah12 UTSW 14 26,707,228 (GRCm38) missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26,801,513 (GRCm38) missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26,735,749 (GRCm38) missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26,878,079 (GRCm38) missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26,799,076 (GRCm38) splice site probably null
R7001:Dnah12 UTSW 14 26,879,724 (GRCm38) missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26,876,998 (GRCm38) missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26,735,680 (GRCm38) missense probably benign
R7107:Dnah12 UTSW 14 26,778,912 (GRCm38) critical splice donor site probably null
R7108:Dnah12 UTSW 14 26,778,912 (GRCm38) critical splice donor site probably null
R7121:Dnah12 UTSW 14 26,778,912 (GRCm38) critical splice donor site probably null
R7122:Dnah12 UTSW 14 26,778,912 (GRCm38) critical splice donor site probably null
R7135:Dnah12 UTSW 14 26,801,413 (GRCm38) missense probably damaging 0.99
R7135:Dnah12 UTSW 14 26,778,912 (GRCm38) critical splice donor site probably null
R7150:Dnah12 UTSW 14 26,861,732 (GRCm38) missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26,814,413 (GRCm38) missense probably benign 0.04
R7201:Dnah12 UTSW 14 26,814,622 (GRCm38) missense probably benign 0.08
R7202:Dnah12 UTSW 14 26,778,912 (GRCm38) critical splice donor site probably null
R7204:Dnah12 UTSW 14 26,781,485 (GRCm38) missense probably damaging 0.99
R7204:Dnah12 UTSW 14 26,778,912 (GRCm38) critical splice donor site probably null
R7205:Dnah12 UTSW 14 26,778,912 (GRCm38) critical splice donor site probably null
R7206:Dnah12 UTSW 14 26,778,912 (GRCm38) critical splice donor site probably null
R7219:Dnah12 UTSW 14 26,854,880 (GRCm38) missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26,766,577 (GRCm38) splice site probably null
R7339:Dnah12 UTSW 14 26,872,320 (GRCm38) missense probably benign
R7363:Dnah12 UTSW 14 26,724,611 (GRCm38) missense probably benign
R7426:Dnah12 UTSW 14 26,724,626 (GRCm38) missense probably benign 0.01
R7472:Dnah12 UTSW 14 26,856,635 (GRCm38) missense probably benign 0.01
R7579:Dnah12 UTSW 14 26,770,503 (GRCm38) missense probably benign 0.05
R7655:Dnah12 UTSW 14 26,859,316 (GRCm38) missense probably benign 0.21
R7656:Dnah12 UTSW 14 26,859,316 (GRCm38) missense probably benign 0.21
R7694:Dnah12 UTSW 14 26,781,380 (GRCm38) missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26,785,933 (GRCm38) missense probably damaging 1.00
R7837:Dnah12 UTSW 14 26,796,219 (GRCm38) missense probably benign 0.01
R7855:Dnah12 UTSW 14 26,829,329 (GRCm38) missense probably benign 0.14
R7870:Dnah12 UTSW 14 26,856,529 (GRCm38) missense probably benign 0.00
R7920:Dnah12 UTSW 14 26,856,542 (GRCm38) missense possibly damaging 0.58
R7933:Dnah12 UTSW 14 26,766,115 (GRCm38) missense probably benign 0.00
R7956:Dnah12 UTSW 14 26,709,272 (GRCm38) missense probably damaging 0.96
R8192:Dnah12 UTSW 14 26,706,881 (GRCm38) missense probably benign
R8263:Dnah12 UTSW 14 26,891,464 (GRCm38) missense noncoding transcript
R8287:Dnah12 UTSW 14 26,812,603 (GRCm38) missense probably benign
R8336:Dnah12 UTSW 14 26,711,065 (GRCm38) missense probably benign 0.01
R8362:Dnah12 UTSW 14 26,854,831 (GRCm38) missense probably damaging 1.00
R8392:Dnah12 UTSW 14 26,885,912 (GRCm38) missense probably benign
R8458:Dnah12 UTSW 14 26,826,892 (GRCm38) critical splice acceptor site probably null
R8481:Dnah12 UTSW 14 26,853,796 (GRCm38) missense probably benign 0.02
R8551:Dnah12 UTSW 14 26,774,270 (GRCm38) missense probably damaging 0.97
R8669:Dnah12 UTSW 14 26,830,625 (GRCm38) splice site probably benign
R8698:Dnah12 UTSW 14 26,707,263 (GRCm38) missense probably benign 0.02
R8709:Dnah12 UTSW 14 26,693,602 (GRCm38) missense probably benign 0.00
R8778:Dnah12 UTSW 14 26,734,563 (GRCm38) missense probably benign 0.29
R9049:Dnah12 UTSW 14 26,722,120 (GRCm38) missense probably benign 0.00
R9087:Dnah12 UTSW 14 26,824,546 (GRCm38) missense probably damaging 1.00
R9099:Dnah12 UTSW 14 26,770,368 (GRCm38) missense probably benign 0.31
R9153:Dnah12 UTSW 14 26,814,612 (GRCm38) missense probably damaging 1.00
R9177:Dnah12 UTSW 14 26,849,298 (GRCm38) missense possibly damaging 0.84
R9214:Dnah12 UTSW 14 26,723,905 (GRCm38) missense probably benign 0.02
R9268:Dnah12 UTSW 14 26,849,298 (GRCm38) missense possibly damaging 0.84
R9274:Dnah12 UTSW 14 26,815,417 (GRCm38) missense probably benign 0.00
R9293:Dnah12 UTSW 14 26,773,059 (GRCm38) missense probably benign
R9322:Dnah12 UTSW 14 26,770,977 (GRCm38) missense possibly damaging 0.75
R9353:Dnah12 UTSW 14 26,856,550 (GRCm38) missense probably damaging 1.00
R9506:Dnah12 UTSW 14 26,792,211 (GRCm38) missense probably benign 0.00
R9518:Dnah12 UTSW 14 26,773,756 (GRCm38) missense probably damaging 1.00
R9524:Dnah12 UTSW 14 26,850,537 (GRCm38) missense probably null 0.91
R9562:Dnah12 UTSW 14 26,875,324 (GRCm38) missense possibly damaging 0.58
R9565:Dnah12 UTSW 14 26,875,324 (GRCm38) missense possibly damaging 0.58
R9573:Dnah12 UTSW 14 26,693,464 (GRCm38) missense probably benign
R9581:Dnah12 UTSW 14 26,770,028 (GRCm38) missense probably damaging 1.00
R9689:Dnah12 UTSW 14 26,868,914 (GRCm38) missense probably null 1.00
R9727:Dnah12 UTSW 14 26,801,553 (GRCm38) nonsense probably null
V7580:Dnah12 UTSW 14 26,773,093 (GRCm38) missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26,773,093 (GRCm38) missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26,814,480 (GRCm38) missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26,816,288 (GRCm38) missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26,814,645 (GRCm38) missense possibly damaging 0.93
Z1177:Dnah12 UTSW 14 26,875,215 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGACCATTTGGCTTGTTC -3'
(R):5'- GAAATTGTACTGAGGAAACACATGC -3'

Sequencing Primer
(F):5'- GTTCTTTTGATGTTCCCAAGTTAAAC -3'
(R):5'- AGGCTGGTCTCAAACTCACTGTG -3'
Posted On 2014-06-23