Incidental Mutation 'R1862:Fbxo16'
ID 204064
Institutional Source Beutler Lab
Gene Symbol Fbxo16
Ensembl Gene ENSMUSG00000034532
Gene Name F-box protein 16
Synonyms Fbx16
MMRRC Submission 039885-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R1862 (G1)
Quality Score 220
Status Not validated
Chromosome 14
Chromosomal Location 65504067-65561422 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65508252 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 23 (T23A)
Ref Sequence ENSEMBL: ENSMUSP00000153094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169656] [ENSMUST00000224629] [ENSMUST00000226005]
AlphaFold Q9QZM9
Predicted Effect probably damaging
Transcript: ENSMUST00000169656
AA Change: T23A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130805
Gene: ENSMUSG00000034532
AA Change: T23A

DomainStartEndE-ValueType
FBOX 92 132 3.43e-3 SMART
low complexity region 194 206 N/A INTRINSIC
low complexity region 323 334 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223608
Predicted Effect probably damaging
Transcript: ENSMUST00000224629
AA Change: T23A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226005
AA Change: T23A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, members of which are characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into three classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbx class. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T A 14: 8,241,416 (GRCm38) E565D probably benign Het
Adam30 A T 3: 98,069,429 (GRCm39) K421* probably null Het
Atp6v1b1 A G 6: 83,726,834 (GRCm39) probably null Het
Cacna1a A T 8: 85,142,559 (GRCm39) I96F possibly damaging Het
Card10 G A 15: 78,664,714 (GRCm39) R747W probably damaging Het
Cdh8 T A 8: 99,917,026 (GRCm39) D363V probably damaging Het
Cecr2 T C 6: 120,734,902 (GRCm39) Y685H probably damaging Het
Cibar1 C T 4: 12,155,717 (GRCm39) V306I possibly damaging Het
Cmklr1 T C 5: 113,752,468 (GRCm39) T178A probably damaging Het
Col16a1 G A 4: 129,986,575 (GRCm39) probably null Het
Col4a1 C T 8: 11,276,439 (GRCm39) probably benign Het
Coro2a T A 4: 46,548,797 (GRCm39) I166F possibly damaging Het
Cry2 T C 2: 92,254,911 (GRCm39) H148R probably damaging Het
Crygd T C 1: 65,101,133 (GRCm39) Y154C probably benign Het
Cubn T C 2: 13,313,372 (GRCm39) Y3066C probably damaging Het
Defb15 C T 8: 22,420,002 (GRCm39) E42K possibly damaging Het
Dnah12 A G 14: 26,418,553 (GRCm39) D147G probably benign Het
Dnah12 A T 14: 26,430,412 (GRCm39) Y340F probably benign Het
Dot1l G T 10: 80,619,373 (GRCm39) R193L probably damaging Het
Dusp29 A G 14: 21,736,757 (GRCm39) V115A probably benign Het
Esd A C 14: 74,979,514 (GRCm39) Y119S probably damaging Het
Esp36 A G 17: 38,730,330 (GRCm39) probably benign Het
Etfbkmt T A 6: 149,045,649 (GRCm39) M1K probably null Het
Exph5 A G 9: 53,287,548 (GRCm39) H1543R probably benign Het
Gorasp2 C A 2: 70,509,808 (GRCm39) H136Q probably damaging Het
Hdc T A 2: 126,439,853 (GRCm39) I367F probably benign Het
Hmcn1 C T 1: 150,514,651 (GRCm39) V3574M probably benign Het
Ilvbl A G 10: 78,419,958 (GRCm39) D592G probably benign Het
Inmt G A 6: 55,151,868 (GRCm39) A34V probably damaging Het
Ints9 A C 14: 65,263,862 (GRCm39) H378P probably benign Het
Kcnh7 T A 2: 62,618,098 (GRCm39) I464L possibly damaging Het
Kcnt2 T A 1: 140,353,068 (GRCm39) V259D probably damaging Het
Lipo3 A G 19: 33,762,092 (GRCm39) F135S probably damaging Het
Lrba T C 3: 86,680,510 (GRCm39) probably null Het
Mapk1 T A 16: 16,844,293 (GRCm39) S22T probably benign Het
Mbd3l2 T C 9: 18,356,217 (GRCm39) S181P possibly damaging Het
Mgat5 C T 1: 127,387,706 (GRCm39) P554L probably damaging Het
Mki67 T C 7: 135,301,090 (GRCm39) T1315A probably benign Het
Mprip C T 11: 59,649,047 (GRCm39) T917M possibly damaging Het
Mroh3 T A 1: 136,113,726 (GRCm39) I688F probably benign Het
Myo1d A T 11: 80,553,874 (GRCm39) Y536N probably damaging Het
Neb C T 2: 52,052,199 (GRCm39) probably null Het
Noc2l A G 4: 156,322,165 (GRCm39) R161G probably benign Het
Nup54 T A 5: 92,567,426 (GRCm39) I375L possibly damaging Het
Nup93 T C 8: 95,032,730 (GRCm39) F539L probably damaging Het
Or10x1 T A 1: 174,197,018 (GRCm39) H178Q probably damaging Het
Or2n1e A G 17: 38,586,235 (GRCm39) E191G probably damaging Het
Or5p57 A C 7: 107,665,932 (GRCm39) Y24* probably null Het
Or8b12 T A 9: 37,658,264 (GRCm39) M278K probably benign Het
Panx1 A T 9: 14,918,724 (GRCm39) D378E probably damaging Het
Papss1 T A 3: 131,288,945 (GRCm39) V170D possibly damaging Het
Pcnx1 T C 12: 81,965,506 (GRCm39) S558P probably damaging Het
Pde3a G T 6: 141,433,239 (GRCm39) A757S probably damaging Het
Pde3a T A 6: 141,196,079 (GRCm39) I255N probably damaging Het
Pdzph1 A G 17: 59,229,578 (GRCm39) Y1027H probably damaging Het
Pkhd1 G T 1: 20,621,244 (GRCm39) R805S probably benign Het
Polr1a G A 6: 71,886,187 (GRCm39) G14D probably damaging Het
Prg4 T A 1: 150,336,420 (GRCm39) D60V probably damaging Het
Ptgr3 T C 18: 84,113,443 (GRCm39) V373A possibly damaging Het
Ptprc T C 1: 138,039,965 (GRCm39) S311G probably benign Het
Rapgefl1 G A 11: 98,733,035 (GRCm39) R205K probably benign Het
Rcan2 A T 17: 44,347,980 (GRCm39) probably null Het
Rock1 A G 18: 10,079,207 (GRCm39) I1087T probably damaging Het
Sectm1b A G 11: 120,945,768 (GRCm39) I191T possibly damaging Het
Septin4 A G 11: 87,458,061 (GRCm39) H145R possibly damaging Het
Setd1b T C 5: 123,285,676 (GRCm39) S241P unknown Het
Slco1a8 T C 6: 141,949,149 (GRCm39) M76V possibly damaging Het
Srpk2 T C 5: 23,729,148 (GRCm39) K497R probably benign Het
Sspo T C 6: 48,467,940 (GRCm39) S4296P probably damaging Het
Syne4 T C 7: 30,016,308 (GRCm39) V168A probably benign Het
Tank T C 2: 61,480,256 (GRCm39) F264S probably damaging Het
Ticrr T C 7: 79,344,955 (GRCm39) S1607P probably damaging Het
Trim30a A G 7: 104,060,405 (GRCm39) V457A probably damaging Het
Trim43b T A 9: 88,967,624 (GRCm39) K336N probably damaging Het
Trim47 T C 11: 115,996,963 (GRCm39) Q598R probably damaging Het
Tspan12 T C 6: 21,851,022 (GRCm39) N18S probably damaging Het
Ubap2 A G 4: 41,221,607 (GRCm39) S231P probably benign Het
Vit A G 17: 78,930,175 (GRCm39) D380G probably damaging Het
Vmn2r2 T C 3: 64,041,942 (GRCm39) N258D possibly damaging Het
Vmn2r52 C T 7: 9,907,333 (GRCm39) C131Y possibly damaging Het
Zfp58 A T 13: 67,639,307 (GRCm39) F395I probably damaging Het
Zfp940 C A 7: 29,544,435 (GRCm39) G491C probably damaging Het
Other mutations in Fbxo16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Fbxo16 APN 14 65,558,736 (GRCm39) missense probably benign 0.15
R1129:Fbxo16 UTSW 14 65,532,981 (GRCm39) missense probably benign
R1423:Fbxo16 UTSW 14 65,524,623 (GRCm39) splice site probably benign
R1776:Fbxo16 UTSW 14 65,532,835 (GRCm39) splice site probably null
R2504:Fbxo16 UTSW 14 65,508,163 (GRCm39) start gained probably benign
R3431:Fbxo16 UTSW 14 65,531,233 (GRCm39) missense probably damaging 0.97
R3432:Fbxo16 UTSW 14 65,531,233 (GRCm39) missense probably damaging 0.97
R3976:Fbxo16 UTSW 14 65,524,606 (GRCm39) missense probably damaging 1.00
R4065:Fbxo16 UTSW 14 65,508,278 (GRCm39) missense probably damaging 1.00
R4922:Fbxo16 UTSW 14 65,536,657 (GRCm39) missense probably benign
R4973:Fbxo16 UTSW 14 65,558,746 (GRCm39) missense probably benign 0.00
R6637:Fbxo16 UTSW 14 65,533,210 (GRCm39) splice site probably null
R7213:Fbxo16 UTSW 14 65,536,868 (GRCm39) splice site probably null
R7274:Fbxo16 UTSW 14 65,558,716 (GRCm39) missense probably benign 0.30
R8871:Fbxo16 UTSW 14 65,531,348 (GRCm39) missense probably damaging 1.00
R8897:Fbxo16 UTSW 14 65,531,287 (GRCm39) missense probably benign 0.11
R9209:Fbxo16 UTSW 14 65,524,594 (GRCm39) missense probably damaging 1.00
Z1088:Fbxo16 UTSW 14 65,531,309 (GRCm39) missense possibly damaging 0.92
Z1177:Fbxo16 UTSW 14 65,536,807 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTGGTAAATAATCTACCCACCTGTACC -3'
(R):5'- TAACCTTTCCCTTGGGCAGG -3'

Sequencing Primer
(F):5'- AATAATCTACCCACCTGTACCTTCTC -3'
(R):5'- GACCCAAATGAGGAAGTCT -3'
Posted On 2014-06-23