Mutagenetix > Incidental Mutation

Incidental Mutation 'R0110:Gli3'

20407

Institutional Source

Beutler Lab

Gene Symbol

Gli3

Ensembl Gene

ENSMUSG00000021318

Gene Name

GLI-Kruppel family member GLI3

Synonyms

brachyphalangy, Bph

MMRRC Submission

038396-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0110 (G1)

Quality Score

196

Status

Validated (trace)

Chromosome

Chromosomal Location

15463235-15730026 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 15724785 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 919 (L919R)

Ref Sequence

ENSEMBL: ENSMUSP00000106137 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110510]

AlphaFold

Q61602

Predicted Effect

probably damaging
Transcript: ENSMUST00000110510
AA Change: L919R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106137
Gene: ENSMUSG00000021318
AA Change: L919R

Domain	Start	End	E-Value	Type
low complexity region	120	136	N/A	INTRINSIC
low complexity region	204	220	N/A	INTRINSIC
low complexity region	324	341	N/A	INTRINSIC
low complexity region	403	421	N/A	INTRINSIC
ZnF_C2H2	480	505	1.53e-1	SMART
ZnF_C2H2	513	540	1.23e0	SMART
ZnF_C2H2	546	570	3.16e-3	SMART
ZnF_C2H2	576	601	4.17e-3	SMART
ZnF_C2H2	607	632	1.4e-4	SMART
low complexity region	703	726	N/A	INTRINSIC
low complexity region	756	763	N/A	INTRINSIC
low complexity region	849	880	N/A	INTRINSIC
low complexity region	934	944	N/A	INTRINSIC
low complexity region	1024	1038	N/A	INTRINSIC
low complexity region	1081	1095	N/A	INTRINSIC
low complexity region	1166	1175	N/A	INTRINSIC

Meta Mutation Damage Score

0.1139

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.0%

Validation Efficiency

98% (105/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger proteins subclass of the Gli family. They are characterized as DNA-binding transcription factors and are mediators of Sonic hedgehog (Shh) signaling. The protein encoded by this gene localizes in the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. Mutations in this gene have been associated with several diseases, including Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, and postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants die perinatally with gross polydactyly, multiple craniofacial defects, and frequently, exencephaly. Heterozygotes exhibit enlarged interfrontal bone and extra preaxial digits. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	A	T	13: 60,853,506		probably benign	Het
4933408B17Rik	A	T	18: 34,596,151	D42E	probably damaging	Het
Abcg3	A	G	5: 104,977,616	I67T	probably damaging	Het
Adam10	T	A	9: 70,748,248	W333R	probably damaging	Het
Ahnak	C	T	19: 9,018,232	R5627*	probably null	Het
AI606181	A	C	19: 41,593,731	K113N	unknown	Het
Alms1	A	T	6: 85,620,369	R1195*	probably null	Het
Ankrd11	T	C	8: 122,892,175	D1646G	possibly damaging	Het
Ap2m1	T	A	16: 20,542,240	I334N	possibly damaging	Het
Arpc1b	T	A	5: 145,127,715	W361R	probably damaging	Het
Baiap2l1	T	C	5: 144,275,891	Y438C	probably damaging	Het
Ccdc110	T	A	8: 45,935,157	N50K	probably benign	Het
Cdhr1	T	C	14: 37,080,676	Y610C	probably damaging	Het
Celsr3	G	A	9: 108,827,005	C229Y	possibly damaging	Het
Clca4b	A	T	3: 144,913,351	Y676N	probably damaging	Het
Cntln	C	T	4: 85,096,757	T1095I	probably damaging	Het
Cog2	T	C	8: 124,529,058		probably null	Het
Col11a1	A	T	3: 114,105,456		probably benign	Het
Cpe	T	A	8: 64,611,467	I233F	probably damaging	Het
Dcaf11	T	C	14: 55,569,080	V446A	probably damaging	Het
Defa34	A	G	8: 21,665,972		probably null	Het
Dnah12	A	G	14: 26,798,899	R1892G	probably damaging	Het
Dock4	A	G	12: 40,621,312		probably benign	Het
Dync1h1	C	A	12: 110,639,944	Q2483K	probably benign	Het
Enpp3	A	T	10: 24,776,781	D759E	probably damaging	Het
Epyc	A	G	10: 97,649,763	T22A	probably benign	Het
Fam227b	T	A	2: 126,100,921	S319C	probably damaging	Het
Fam83a	C	A	15: 58,009,926	Q384K	probably benign	Het
Fam83b	G	T	9: 76,492,826	L332I	possibly damaging	Het
Gal3st2c	C	T	1: 94,009,497	P388L	probably benign	Het
Ggn	C	T	7: 29,171,296	P47S	probably damaging	Het
Gm5134	C	A	10: 75,974,245	T120N	probably benign	Het
Gm5415	T	A	1: 32,545,875	N318I	possibly damaging	Het
Gm8251	C	A	1: 44,059,224	V905F	probably benign	Het
Gmip	C	T	8: 69,815,609		probably benign	Het
Gpr39	C	T	1: 125,677,500	T55M	probably damaging	Het
Grk4	A	G	5: 34,716,213	T208A	probably damaging	Het
Gsdme	C	A	6: 50,246,127		probably benign	Het
Gucy2e	T	C	11: 69,235,576	D326G	probably benign	Het
Hadhb	T	C	5: 30,169,485		probably benign	Het
Hectd4	T	A	5: 121,281,896	Y635N	possibly damaging	Het
Hectd4	G	A	5: 121,305,673	E1319K	possibly damaging	Het
Ikbkb	A	T	8: 22,671,635	C412*	probably null	Het
Itpa	A	T	2: 130,679,418		probably benign	Het
Klhl10	A	G	11: 100,456,932	T605A	probably benign	Het
Krt74	T	C	15: 101,763,316		noncoding transcript	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lap3	T	C	5: 45,495,290		probably benign	Het
Lrrc10	T	A	10: 117,045,790	L123Q	probably damaging	Het
Map3k6	T	C	4: 133,243,794	L273P	probably damaging	Het
Mbl1	A	G	14: 41,158,749	N198S	probably damaging	Het
Mcf2l	A	G	8: 12,997,337	D233G	probably damaging	Het
Mdga2	T	C	12: 66,470,926	K45E	possibly damaging	Het
Mdn1	A	G	4: 32,738,619	N3524S	probably benign	Het
Mrc1	T	A	2: 14,238,542		probably benign	Het
Msto1	A	G	3: 88,911,541	L269P	probably benign	Het
Mtcl1	C	T	17: 66,358,114	E1149K	possibly damaging	Het
Naca	C	T	10: 128,044,790	A1897V	probably benign	Het
Ncapg	T	C	5: 45,693,147		probably benign	Het
Neb	A	T	2: 52,290,743		probably benign	Het
Olfr467	T	C	7: 107,814,688	Y35H	probably damaging	Het
Olfr870	T	C	9: 20,171,265	Y102C	probably benign	Het
Olfr944	G	A	9: 39,217,728	V124I	possibly damaging	Het
Parp2	T	A	14: 50,819,673	Y361N	probably damaging	Het
Parp3	A	G	9: 106,471,796	F466L	possibly damaging	Het
Pcdh15	A	T	10: 74,290,976	N296Y	probably damaging	Het
Pcf11	G	A	7: 92,657,831	P1043L	probably damaging	Het
Pdzrn3	A	T	6: 101,151,053	I884N	probably damaging	Het
Phf24	G	T	4: 42,933,761	V48L	possibly damaging	Het
Pla2g4a	T	A	1: 149,840,647	M688L	possibly damaging	Het
Plcl2	T	C	17: 50,607,982	L673P	probably damaging	Het
Ppp1r3c	A	T	19: 36,734,217	F51Y	possibly damaging	Het
Prmt1	A	G	7: 44,978,801		probably benign	Het
Proc	G	A	18: 32,125,118	T258I	probably benign	Het
Prom2	T	G	2: 127,531,113	S679R	possibly damaging	Het
Psen2	T	C	1: 180,238,914	T153A	probably damaging	Het
Rem2	T	C	14: 54,476,297		probably benign	Het
Rin2	A	G	2: 145,861,033	K550E	probably benign	Het
Rtn4	T	A	11: 29,733,849		probably benign	Het
Ssh1	A	T	5: 113,946,705	D448E	probably benign	Het
Ssmem1	A	T	6: 30,519,548		probably null	Het
Stam2	A	T	2: 52,719,986		probably benign	Het
Syne1	A	G	10: 5,367,600	L498P	probably damaging	Het
Syne2	AGAGTGAG	AGAGTGAGTGAG	12: 76,097,960		probably null	Het
Taf6l	G	T	19: 8,778,521	H254Q	probably benign	Het
Tas2r123	T	C	6: 132,847,332	V64A	probably benign	Het
Tnnc1	A	G	14: 31,211,408	D149G	probably damaging	Het
Tpp2	T	A	1: 43,978,504	V756E	probably benign	Het
Tpp2	A	G	1: 43,999,693	D1133G	probably damaging	Het
Traf3ip3	T	A	1: 193,178,231		probably null	Het
Tsen15	A	G	1: 152,371,797	V148A	probably damaging	Het
Ttn	T	A	2: 76,864,328		probably benign	Het
Ube2u	A	G	4: 100,486,673	I90V	probably benign	Het
Unc79	T	A	12: 103,079,070		probably null	Het
Usp47	T	C	7: 112,056,580	S155P	possibly damaging	Het
Wdr41	T	C	13: 95,018,111		probably benign	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zfp423	A	G	8: 87,782,259	S486P	possibly damaging	Het
Zfp628	A	T	7: 4,919,733	Q318L	probably benign	Het

Other mutations in Gli3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Gli3	APN	13	15644299	missense	probably damaging	1.00
IGL00471:Gli3	APN	13	15723769	critical splice donor site	probably null
IGL00484:Gli3	APN	13	15644392	missense	possibly damaging	0.84
IGL00588:Gli3	APN	13	15644392	missense	possibly damaging	0.84
IGL01161:Gli3	APN	13	15548398	critical splice acceptor site	probably null
IGL01633:Gli3	APN	13	15648634	missense	probably damaging	1.00
IGL01799:Gli3	APN	13	15726161	missense	probably benign	0.00
IGL01861:Gli3	APN	13	15725325	missense	probably damaging	1.00
IGL02063:Gli3	APN	13	15726372	missense	possibly damaging	0.94
IGL02112:Gli3	APN	13	15662514	missense	probably damaging	1.00
IGL02255:Gli3	APN	13	15648719	missense	probably damaging	1.00
IGL02270:Gli3	APN	13	15726786	utr 3 prime	probably benign
IGL02336:Gli3	APN	13	15720289	missense	probably damaging	1.00
IGL02346:Gli3	APN	13	15723693	missense	probably damaging	1.00
IGL02744:Gli3	APN	13	15613886	critical splice donor site	probably null
IGL02877:Gli3	APN	13	15724742	missense	probably damaging	1.00
IGL02975:Gli3	APN	13	15724568	missense	probably damaging	1.00
IGL03018:Gli3	APN	13	15660132	missense	probably damaging	1.00
IGL03378:Gli3	APN	13	15644420	missense	probably damaging	1.00
IGL03406:Gli3	APN	13	15648581	missense	probably damaging	1.00
Capone	UTSW	13	15715034	missense	probably damaging	1.00
Carpals	UTSW	13	15713650	critical splice donor site	probably null
Ness	UTSW	13	15723555	missense	probably damaging	1.00
FR4737:Gli3	UTSW	13	15644357	missense	probably damaging	1.00
R0329:Gli3	UTSW	13	15723558	missense	probably damaging	0.98
R0330:Gli3	UTSW	13	15723558	missense	probably damaging	0.98
R0360:Gli3	UTSW	13	15724764	missense	probably benign	0.32
R0364:Gli3	UTSW	13	15724764	missense	probably benign	0.32
R0469:Gli3	UTSW	13	15724785	missense	probably damaging	1.00
R0616:Gli3	UTSW	13	15662406	missense	possibly damaging	0.75
R0639:Gli3	UTSW	13	15724715	missense	probably damaging	1.00
R1072:Gli3	UTSW	13	15713605	missense	probably damaging	1.00
R1257:Gli3	UTSW	13	15725996	nonsense	probably null
R1270:Gli3	UTSW	13	15723744	missense	probably benign	0.02
R1424:Gli3	UTSW	13	15726314	missense	probably benign	0.00
R1481:Gli3	UTSW	13	15613850	missense	probably damaging	0.99
R1596:Gli3	UTSW	13	15725471	missense	possibly damaging	0.74
R1628:Gli3	UTSW	13	15726312	missense	probably benign	0.00
R1721:Gli3	UTSW	13	15726297	missense	probably benign	0.27
R1797:Gli3	UTSW	13	15713512	missense	probably damaging	0.99
R1813:Gli3	UTSW	13	15648691	missense	probably damaging	1.00
R1819:Gli3	UTSW	13	15725792	nonsense	probably null
R1988:Gli3	UTSW	13	15726380	missense	probably benign
R2132:Gli3	UTSW	13	15725549	missense	possibly damaging	0.74
R2352:Gli3	UTSW	13	15662392	missense	probably benign	0.02
R3085:Gli3	UTSW	13	15660941	missense	probably damaging	1.00
R3177:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R3277:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R4162:Gli3	UTSW	13	15725115	missense	possibly damaging	0.93
R4497:Gli3	UTSW	13	15723571	missense	possibly damaging	0.74
R4526:Gli3	UTSW	13	15713631	missense	probably damaging	1.00
R4979:Gli3	UTSW	13	15724464	missense	possibly damaging	0.87
R5327:Gli3	UTSW	13	15548507	missense	probably damaging	0.99
R5395:Gli3	UTSW	13	15714950	missense	probably damaging	1.00
R5494:Gli3	UTSW	13	15725982	missense	probably benign	0.28
R5609:Gli3	UTSW	13	15548453	missense	possibly damaging	0.82
R5718:Gli3	UTSW	13	15478165	critical splice donor site	probably null
R5810:Gli3	UTSW	13	15644309	missense	probably damaging	0.99
R5896:Gli3	UTSW	13	15726180	missense	probably benign	0.00
R5930:Gli3	UTSW	13	15548625	missense	probably damaging	1.00
R5964:Gli3	UTSW	13	15726162	nonsense	probably null
R5985:Gli3	UTSW	13	15723555	missense	probably damaging	1.00
R6224:Gli3	UTSW	13	15725145	missense	probably benign
R6278:Gli3	UTSW	13	15725113	missense	possibly damaging	0.69
R6330:Gli3	UTSW	13	15724732	missense	probably damaging	1.00
R6383:Gli3	UTSW	13	15723555	missense	probably damaging	1.00
R6523:Gli3	UTSW	13	15713650	critical splice donor site	probably null
R7072:Gli3	UTSW	13	15725695	missense	possibly damaging	0.51
R7085:Gli3	UTSW	13	15715062	missense	probably damaging	1.00
R7228:Gli3	UTSW	13	15724502	missense	probably benign	0.00
R7327:Gli3	UTSW	13	15725559	missense	probably benign	0.02
R7451:Gli3	UTSW	13	15726291	missense	possibly damaging	0.50
R7974:Gli3	UTSW	13	15726256	missense	probably benign	0.00
R8167:Gli3	UTSW	13	15725643	missense	probably benign	0.00
R8170:Gli3	UTSW	13	15720208	missense	probably benign
R8199:Gli3	UTSW	13	15725991	missense	probably benign	0.08
R8247:Gli3	UTSW	13	15726775	missense	possibly damaging	0.82
R8332:Gli3	UTSW	13	15713548	missense	possibly damaging	0.58
R8347:Gli3	UTSW	13	15723525	missense	probably damaging	1.00
R8559:Gli3	UTSW	13	15660132	missense	probably damaging	1.00
R8676:Gli3	UTSW	13	15715034	missense	probably damaging	1.00
R8905:Gli3	UTSW	13	15726531	missense	probably benign	0.01
R9099:Gli3	UTSW	13	15726735	missense	probably damaging	1.00
R9260:Gli3	UTSW	13	15725090	missense	probably damaging	0.99
R9317:Gli3	UTSW	13	15715073	missense	probably damaging	1.00
R9475:Gli3	UTSW	13	15725711	missense	possibly damaging	0.87
R9546:Gli3	UTSW	13	15613858	missense	probably benign	0.00
R9571:Gli3	UTSW	13	15726273	missense	probably benign	0.00
R9621:Gli3	UTSW	13	15726668	missense	probably benign	0.01
R9704:Gli3	UTSW	13	15723473	missense	probably damaging	1.00
R9787:Gli3	UTSW	13	15725801	missense	probably damaging	0.96
RF010:Gli3	UTSW	13	15726369	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTGCTGAACACACTCAACAGGAGAG -3'
(R):5'- GCTAGTGCATCATGAGGCATCAGG -3'

Sequencing Primer
(F):5'- ATCAGCTCTGCCTACCTGAG -3'
(R):5'- GACGCCCTCTGTATGTGTGAC -3'

Posted On

2013-04-11