Incidental Mutation 'R1863:Col6a5'
ID204124
Institutional Source Beutler Lab
Gene Symbol Col6a5
Ensembl Gene ENSMUSG00000091345
Gene Namecollagen, type VI, alpha 5
SynonymsGm7455, Col6a5
MMRRC Submission 039886-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.889) question?
Stock #R1863 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location105856078-105960643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105940201 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 304 (M304L)
Ref Sequence ENSEMBL: ENSMUSP00000139398 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165165] [ENSMUST00000190193]
Predicted Effect unknown
Transcript: ENSMUST00000165165
AA Change: M304L
SMART Domains Protein: ENSMUSP00000131146
Gene: ENSMUSG00000091345
AA Change: M304L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.8e-24 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 2.23e-20 SMART
VWA 472 649 6.84e-39 SMART
VWA 658 834 1.52e-45 SMART
VWA 844 1024 2.44e-44 SMART
VWA 1035 1208 2.95e-20 SMART
Pfam:Collagen 1425 1478 3.3e-8 PFAM
low complexity region 1493 1508 N/A INTRINSIC
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 9.6e-10 PFAM
low complexity region 1711 1730 N/A INTRINSIC
low complexity region 1739 1757 N/A INTRINSIC
VWA 1788 1964 1.99e-17 SMART
VWA 1994 2173 5.98e-21 SMART
VWA 2319 2513 4.4e-19 SMART
Predicted Effect unknown
Transcript: ENSMUST00000190193
AA Change: M304L
SMART Domains Protein: ENSMUSP00000139398
Gene: ENSMUSG00000091345
AA Change: M304L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 28 200 1.1e-26 SMART
low complexity region 222 248 N/A INTRINSIC
VWA 266 439 1.4e-22 SMART
VWA 472 649 4.4e-41 SMART
VWA 658 834 9.5e-48 SMART
VWA 844 1024 1.6e-46 SMART
VWA 1035 1208 1.9e-22 SMART
Pfam:Collagen 1425 1478 1.2e-6 PFAM
Pfam:Collagen 1457 1530 5.9e-6 PFAM
low complexity region 1535 1552 N/A INTRINSIC
Pfam:Collagen 1555 1616 3.6e-8 PFAM
Pfam:Collagen 1631 1691 8.4e-6 PFAM
Pfam:Collagen 1706 1764 6.6e-6 PFAM
VWA 1788 1964 1.2e-19 SMART
VWA 1994 2173 3.7e-23 SMART
VWA 2319 2513 2.8e-21 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.0%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the collagen superfamily of proteins. The encoded protein contains multiple von Willebrand factor A-like domains and may interact with the alpha 1 and alpha 2 chains of collagen VI to form the complete collagen VI trimer. Polymorphisms in this gene may be linked to dermal phenotypes, such as eczema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,228,593 I2108V probably benign Het
A2ml1 A T 6: 128,550,783 S1015T probably damaging Het
Adamts10 T A 17: 33,551,432 probably null Het
Adgrv1 G A 13: 81,563,566 T1097I probably damaging Het
Apeh T C 9: 108,092,103 Y274C possibly damaging Het
Apobec3 A G 15: 79,897,867 D26G possibly damaging Het
Arg2 C T 12: 79,150,020 Q172* probably null Het
Asb18 C T 1: 90,014,382 V66I probably benign Het
Cacna1i G A 15: 80,358,931 G430S probably damaging Het
Cadps A G 14: 12,449,802 S1136P possibly damaging Het
Cadps A G 14: 12,505,796 V758A probably benign Het
Calhm3 A G 19: 47,152,100 W185R probably damaging Het
Car5b T C X: 163,991,373 D146G probably damaging Het
Card10 G A 15: 78,780,514 R747W probably damaging Het
Cd300lg T G 11: 102,041,604 V5G probably damaging Het
Cd46 C A 1: 195,083,623 G145C probably damaging Het
Chit1 T C 1: 134,151,250 S433P probably damaging Het
Cntrl G A 2: 35,118,119 E182K possibly damaging Het
Cpxm2 C T 7: 132,143,663 probably null Het
Dbf4 G A 5: 8,397,375 Q612* probably null Het
Dnah11 G C 12: 118,063,852 Q1835E possibly damaging Het
Ehbp1l1 A T 19: 5,717,854 N1140K probably benign Het
Eps8l1 C A 7: 4,465,360 probably benign Het
Fbxl21 A T 13: 56,527,063 I76L probably benign Het
Gcnt2 A T 13: 40,861,101 K249N possibly damaging Het
Gm11487 A T 4: 73,401,800 Y247* probably null Het
Gm5819 A G 18: 8,694,179 T35A probably benign Het
Gm8180 T C 14: 43,783,682 E23G probably benign Het
Gorab A G 1: 163,403,562 F8L probably damaging Het
Hlf A G 11: 90,340,826 L274S probably damaging Het
Il15ra T A 2: 11,723,436 S137T possibly damaging Het
Krt78 A T 15: 101,946,569 C936S possibly damaging Het
Lamb2 T C 9: 108,481,384 S207P probably benign Het
Lce1a1 T C 3: 92,646,811 S119G unknown Het
Lipo1 A G 19: 33,784,692 F135S probably damaging Het
Lrp4 T A 2: 91,498,363 L1536Q probably benign Het
Lrrc25 T C 8: 70,617,946 S126P possibly damaging Het
Mbd3l2 T C 9: 18,444,921 S181P possibly damaging Het
Mss51 C T 14: 20,484,868 R278H probably damaging Het
Myom3 G A 4: 135,778,037 M412I probably benign Het
Naa25 T C 5: 121,435,548 V780A probably benign Het
Naip6 A T 13: 100,300,559 F485L probably benign Het
Notch1 T C 2: 26,469,950 Y1251C probably damaging Het
Npas3 A G 12: 54,068,826 N826D probably damaging Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Olfr1247 A T 2: 89,609,709 L131* probably null Het
Olfr1260 A T 2: 89,978,410 I211F probably benign Het
Olfr143 T G 9: 38,253,720 M101R probably damaging Het
Olfr285 G T 15: 98,313,491 Q20K probably benign Het
Olfr328 T C 11: 58,552,023 Y72C probably benign Het
Olfr480 A C 7: 108,066,725 Y24* probably null Het
Olfr798 T C 10: 129,625,348 T238A probably damaging Het
Osbpl6 G A 2: 76,585,058 R588H probably damaging Het
Pcdhb17 A T 18: 37,486,111 D318V probably benign Het
Pcnx2 T A 8: 125,818,786 E1162V probably damaging Het
Pde2a G A 7: 101,511,154 R845H probably damaging Het
Pkhd1 G T 1: 20,551,020 R805S probably benign Het
Ppl T C 16: 5,087,980 K1484E possibly damaging Het
Pramel7 T C 2: 87,491,331 E120G probably benign Het
Prg4 T A 1: 150,460,669 D60V probably damaging Het
Prpf6 T A 2: 181,608,174 D42E possibly damaging Het
Rbm5 C T 9: 107,750,519 V408I possibly damaging Het
Rsrp1 G T 4: 134,924,077 D51Y unknown Het
Sec22a A G 16: 35,347,718 M141T probably damaging Het
Spryd3 A G 15: 102,117,659 S417P probably benign Het
Sptbn2 A G 19: 4,732,685 M550V possibly damaging Het
Sugt1 C T 14: 79,608,994 T157I probably damaging Het
Syne4 T C 7: 30,316,883 V168A probably benign Het
Tas2r122 A T 6: 132,711,102 L276* probably null Het
Tbc1d14 G A 5: 36,507,693 S231F probably damaging Het
Tenm3 T A 8: 48,276,346 I1526F probably benign Het
Tgm2 C T 2: 158,124,219 C505Y probably damaging Het
Thop1 T C 10: 81,073,317 Y61H probably damaging Het
Ticam1 G A 17: 56,271,436 H220Y probably damaging Het
Tle6 T C 10: 81,591,921 D500G possibly damaging Het
Tm6sf2 T A 8: 70,079,725 L345Q probably damaging Het
Tnxb T C 17: 34,670,874 C114R probably damaging Het
Topors G T 4: 40,262,149 C378* probably null Het
Ttc6 G A 12: 57,714,095 G1544R probably benign Het
Vmn2r4 A T 3: 64,406,989 N190K probably benign Het
Wdr70 C A 15: 7,920,573 V447F probably benign Het
Xpa A G 4: 46,155,730 probably benign Het
Xrcc1 T C 7: 24,570,575 S474P possibly damaging Het
Zfp658 T G 7: 43,573,899 F533V possibly damaging Het
Zfp799 G A 17: 32,819,400 H631Y probably damaging Het
Other mutations in Col6a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Col6a5 APN 9 105882683 missense probably damaging 1.00
IGL01462:Col6a5 APN 9 105946075 missense unknown
IGL01530:Col6a5 APN 9 105915186 splice site probably benign
IGL01717:Col6a5 APN 9 105940273 missense unknown
IGL01859:Col6a5 APN 9 105930961 nonsense probably null
IGL01945:Col6a5 APN 9 105928290 missense unknown
IGL01985:Col6a5 APN 9 105937283 missense unknown
IGL02128:Col6a5 APN 9 105939894 missense unknown
IGL02170:Col6a5 APN 9 105928422 missense unknown
IGL02224:Col6a5 APN 9 105864335 missense probably damaging 1.00
IGL02246:Col6a5 APN 9 105911107 nonsense probably null
IGL02304:Col6a5 APN 9 105928414 missense unknown
IGL02338:Col6a5 APN 9 105878630 missense probably damaging 1.00
IGL02375:Col6a5 APN 9 105906113 missense unknown
IGL02660:Col6a5 APN 9 105936886 missense unknown
IGL02829:Col6a5 APN 9 105934307 missense unknown
IGL02882:Col6a5 APN 9 105934321 missense unknown
IGL02973:Col6a5 APN 9 105925821 missense unknown
IGL03089:Col6a5 APN 9 105933839 missense unknown
IGL03100:Col6a5 APN 9 105937313 missense unknown
IGL03257:Col6a5 APN 9 105881873 missense possibly damaging 0.95
FR4340:Col6a5 UTSW 9 105934174 missense unknown
FR4342:Col6a5 UTSW 9 105934174 missense unknown
FR4589:Col6a5 UTSW 9 105934174 missense unknown
PIT4131001:Col6a5 UTSW 9 105881914 missense probably damaging 0.98
R0147:Col6a5 UTSW 9 105925794 missense unknown
R0549:Col6a5 UTSW 9 105904579 splice site probably benign
R0622:Col6a5 UTSW 9 105925852 missense unknown
R0628:Col6a5 UTSW 9 105912450 splice site probably null
R0635:Col6a5 UTSW 9 105928606 missense unknown
R0644:Col6a5 UTSW 9 105948324 critical splice donor site probably null
R0828:Col6a5 UTSW 9 105862064 critical splice acceptor site probably null
R0972:Col6a5 UTSW 9 105940285 missense unknown
R1065:Col6a5 UTSW 9 105881783 missense probably damaging 0.99
R1142:Col6a5 UTSW 9 105934317 missense unknown
R1169:Col6a5 UTSW 9 105896974 splice site probably null
R1522:Col6a5 UTSW 9 105939994 missense unknown
R1646:Col6a5 UTSW 9 105862749 nonsense probably null
R1719:Col6a5 UTSW 9 105931293 missense unknown
R1759:Col6a5 UTSW 9 105930846 missense unknown
R1780:Col6a5 UTSW 9 105936878 missense unknown
R1812:Col6a5 UTSW 9 105928054 missense unknown
R1838:Col6a5 UTSW 9 105864833 missense probably benign 0.28
R1839:Col6a5 UTSW 9 105864833 missense probably benign 0.28
R1900:Col6a5 UTSW 9 105931213 missense unknown
R1951:Col6a5 UTSW 9 105936957 missense unknown
R2024:Col6a5 UTSW 9 105936994 missense unknown
R2126:Col6a5 UTSW 9 105945600 missense unknown
R2319:Col6a5 UTSW 9 105937218 missense unknown
R2344:Col6a5 UTSW 9 105928537 missense unknown
R2483:Col6a5 UTSW 9 105864148 missense probably damaging 1.00
R3176:Col6a5 UTSW 9 105911107 nonsense probably null
R3276:Col6a5 UTSW 9 105911107 nonsense probably null
R3438:Col6a5 UTSW 9 105875792 missense possibly damaging 0.88
R3791:Col6a5 UTSW 9 105864669 missense probably damaging 0.99
R3840:Col6a5 UTSW 9 105928611 missense unknown
R3886:Col6a5 UTSW 9 105930930 missense unknown
R3941:Col6a5 UTSW 9 105939834 missense unknown
R4194:Col6a5 UTSW 9 105945914 missense unknown
R4399:Col6a5 UTSW 9 105888965 missense possibly damaging 0.75
R4421:Col6a5 UTSW 9 105928473 missense unknown
R4450:Col6a5 UTSW 9 105904521 missense unknown
R4491:Col6a5 UTSW 9 105940012 missense unknown
R4582:Col6a5 UTSW 9 105862764 missense probably benign 0.17
R4693:Col6a5 UTSW 9 105937172 missense unknown
R4787:Col6a5 UTSW 9 105931081 missense unknown
R4789:Col6a5 UTSW 9 105937335 missense unknown
R4791:Col6a5 UTSW 9 105930784 missense unknown
R4792:Col6a5 UTSW 9 105930784 missense unknown
R4817:Col6a5 UTSW 9 105934298 missense unknown
R4854:Col6a5 UTSW 9 105898751 missense probably benign 0.18
R4927:Col6a5 UTSW 9 105933964 missense unknown
R4969:Col6a5 UTSW 9 105864607 missense probably damaging 1.00
R5037:Col6a5 UTSW 9 105928138 missense unknown
R5118:Col6a5 UTSW 9 105937005 missense unknown
R5144:Col6a5 UTSW 9 105889283 missense probably damaging 1.00
R5145:Col6a5 UTSW 9 105934245 missense unknown
R5160:Col6a5 UTSW 9 105931009 missense unknown
R5182:Col6a5 UTSW 9 105857332 nonsense probably null
R5234:Col6a5 UTSW 9 105864205 missense probably damaging 1.00
R5252:Col6a5 UTSW 9 105940290 missense unknown
R5290:Col6a5 UTSW 9 105946083 missense unknown
R5313:Col6a5 UTSW 9 105945544 missense unknown
R5321:Col6a5 UTSW 9 105928465 missense unknown
R5466:Col6a5 UTSW 9 105931083 missense unknown
R5540:Col6a5 UTSW 9 105862776 missense probably benign 0.44
R5669:Col6a5 UTSW 9 105925998 missense unknown
R5789:Col6a5 UTSW 9 105864608 missense possibly damaging 0.91
R5801:Col6a5 UTSW 9 105948367 missense unknown
R5827:Col6a5 UTSW 9 105928120 nonsense probably null
R5839:Col6a5 UTSW 9 105945393 critical splice donor site probably null
R5908:Col6a5 UTSW 9 105862801 missense possibly damaging 0.88
R5970:Col6a5 UTSW 9 105945847 missense unknown
R6045:Col6a5 UTSW 9 105925918 missense unknown
R6107:Col6a5 UTSW 9 105892272 nonsense probably null
R6168:Col6a5 UTSW 9 105875787 critical splice donor site probably null
R6315:Col6a5 UTSW 9 105881970 missense probably damaging 1.00
R6317:Col6a5 UTSW 9 105889067 missense probably damaging 1.00
R6414:Col6a5 UTSW 9 105892266 splice site probably null
R6434:Col6a5 UTSW 9 105937345 missense unknown
R6456:Col6a5 UTSW 9 105945477 missense unknown
R6698:Col6a5 UTSW 9 105934175 missense unknown
R6876:Col6a5 UTSW 9 105937307 missense unknown
R6882:Col6a5 UTSW 9 105940270 nonsense probably null
R6928:Col6a5 UTSW 9 105939919 missense unknown
R7024:Col6a5 UTSW 9 105912475 nonsense probably null
R7038:Col6a5 UTSW 9 105945738 missense unknown
R7082:Col6a5 UTSW 9 105931239 missense unknown
R7158:Col6a5 UTSW 9 105864208 missense possibly damaging 0.90
R7211:Col6a5 UTSW 9 105928164 missense unknown
R7431:Col6a5 UTSW 9 105928269 missense unknown
R7440:Col6a5 UTSW 9 105881431 nonsense probably null
R7502:Col6a5 UTSW 9 105875876 missense probably benign 0.05
X0054:Col6a5 UTSW 9 105915158 missense unknown
X0058:Col6a5 UTSW 9 105881778 nonsense probably null
Z1088:Col6a5 UTSW 9 105926067 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGGACTCTGAGAAGCCTTC -3'
(R):5'- GCATCTCAACCATCCTGGAAG -3'

Sequencing Primer
(F):5'- GGACTCTGAGAAGCCTTCTTTCC -3'
(R):5'- AGGCCAGTGGTCTTTCCTAAC -3'
Posted On2014-06-23