Mutagenetix > Incidental Mutation

Incidental Mutation 'R0110:Ahnak'

20424

Institutional Source

Beutler Lab

Gene Symbol

Ahnak

Ensembl Gene

ENSMUSG00000069833

Gene Name

AHNAK nucleoprotein (desmoyokin)

Synonyms

1110004P15Rik, 2310047C17Rik, DY6

MMRRC Submission

038396-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.491) question?

Stock #

R0110 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

8989284-9076919 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 9018232 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 5627 (R5627*)

Ref Sequence

ENSEMBL: ENSMUSP00000090633 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092955] [ENSMUST00000092956]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000092955

SMART Domains

Protein: ENSMUSP00000090632
Gene: ENSMUSG00000069833

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
PDZ	20	91	2.31e-5	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000092956
AA Change: R5627*

SMART Domains

Protein: ENSMUSP00000090633
Gene: ENSMUSG00000069833
AA Change: R5627*

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
PDZ	20	91	2.31e-5	SMART
internal_repeat_2	163	1515	5.22e-182	PROSPERO
internal_repeat_1	224	2314	N/A	PROSPERO
internal_repeat_2	1532	3028	5.22e-182	PROSPERO
internal_repeat_1	2660	5095	N/A	PROSPERO
low complexity region	5336	5353	N/A	INTRINSIC
low complexity region	5493	5504	N/A	INTRINSIC
low complexity region	5580	5600	N/A	INTRINSIC
low complexity region	5620	5636	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 95.3%
20x: 89.0%

Validation Efficiency

98% (105/107)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a large (700 kDa) structural scaffold protein consisting of a central domain with 128 aa repeats. The encoded protein may play a role in such diverse processes as blood-brain barrier formation, cell structure and migration, cardiac calcium channel regulation, and tumor metastasis. A much shorter variant encoding a 17 kDa isoform exists for this gene, and the shorter isoform initiates a feedback loop that regulates alternative splicing of this gene. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit decreased T cell proliferation and increased susceptibility to parasitic infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930486L24Rik	A	T	13: 60,853,506		probably benign	Het
4933408B17Rik	A	T	18: 34,596,151	D42E	probably damaging	Het
Abcg3	A	G	5: 104,977,616	I67T	probably damaging	Het
Adam10	T	A	9: 70,748,248	W333R	probably damaging	Het
AI606181	A	C	19: 41,593,731	K113N	unknown	Het
Alms1	A	T	6: 85,620,369	R1195*	probably null	Het
Ankrd11	T	C	8: 122,892,175	D1646G	possibly damaging	Het
Ap2m1	T	A	16: 20,542,240	I334N	possibly damaging	Het
Arpc1b	T	A	5: 145,127,715	W361R	probably damaging	Het
Baiap2l1	T	C	5: 144,275,891	Y438C	probably damaging	Het
Ccdc110	T	A	8: 45,935,157	N50K	probably benign	Het
Cdhr1	T	C	14: 37,080,676	Y610C	probably damaging	Het
Celsr3	G	A	9: 108,827,005	C229Y	possibly damaging	Het
Clca4b	A	T	3: 144,913,351	Y676N	probably damaging	Het
Cntln	C	T	4: 85,096,757	T1095I	probably damaging	Het
Cog2	T	C	8: 124,529,058		probably null	Het
Col11a1	A	T	3: 114,105,456		probably benign	Het
Cpe	T	A	8: 64,611,467	I233F	probably damaging	Het
Dcaf11	T	C	14: 55,569,080	V446A	probably damaging	Het
Defa34	A	G	8: 21,665,972		probably null	Het
Dnah12	A	G	14: 26,798,899	R1892G	probably damaging	Het
Dock4	A	G	12: 40,621,312		probably benign	Het
Dync1h1	C	A	12: 110,639,944	Q2483K	probably benign	Het
Enpp3	A	T	10: 24,776,781	D759E	probably damaging	Het
Epyc	A	G	10: 97,649,763	T22A	probably benign	Het
Fam227b	T	A	2: 126,100,921	S319C	probably damaging	Het
Fam83a	C	A	15: 58,009,926	Q384K	probably benign	Het
Fam83b	G	T	9: 76,492,826	L332I	possibly damaging	Het
Gal3st2c	C	T	1: 94,009,497	P388L	probably benign	Het
Ggn	C	T	7: 29,171,296	P47S	probably damaging	Het
Gli3	T	G	13: 15,724,785	L919R	probably damaging	Het
Gm5134	C	A	10: 75,974,245	T120N	probably benign	Het
Gm5415	T	A	1: 32,545,875	N318I	possibly damaging	Het
Gm8251	C	A	1: 44,059,224	V905F	probably benign	Het
Gmip	C	T	8: 69,815,609		probably benign	Het
Gpr39	C	T	1: 125,677,500	T55M	probably damaging	Het
Grk4	A	G	5: 34,716,213	T208A	probably damaging	Het
Gsdme	C	A	6: 50,246,127		probably benign	Het
Gucy2e	T	C	11: 69,235,576	D326G	probably benign	Het
Hadhb	T	C	5: 30,169,485		probably benign	Het
Hectd4	T	A	5: 121,281,896	Y635N	possibly damaging	Het
Hectd4	G	A	5: 121,305,673	E1319K	possibly damaging	Het
Ikbkb	A	T	8: 22,671,635	C412*	probably null	Het
Itpa	A	T	2: 130,679,418		probably benign	Het
Klhl10	A	G	11: 100,456,932	T605A	probably benign	Het
Krt74	T	C	15: 101,763,316		noncoding transcript	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Lap3	T	C	5: 45,495,290		probably benign	Het
Lrrc10	T	A	10: 117,045,790	L123Q	probably damaging	Het
Map3k6	T	C	4: 133,243,794	L273P	probably damaging	Het
Mbl1	A	G	14: 41,158,749	N198S	probably damaging	Het
Mcf2l	A	G	8: 12,997,337	D233G	probably damaging	Het
Mdga2	T	C	12: 66,470,926	K45E	possibly damaging	Het
Mdn1	A	G	4: 32,738,619	N3524S	probably benign	Het
Mrc1	T	A	2: 14,238,542		probably benign	Het
Msto1	A	G	3: 88,911,541	L269P	probably benign	Het
Mtcl1	C	T	17: 66,358,114	E1149K	possibly damaging	Het
Naca	C	T	10: 128,044,790	A1897V	probably benign	Het
Ncapg	T	C	5: 45,693,147		probably benign	Het
Neb	A	T	2: 52,290,743		probably benign	Het
Olfr467	T	C	7: 107,814,688	Y35H	probably damaging	Het
Olfr870	T	C	9: 20,171,265	Y102C	probably benign	Het
Olfr944	G	A	9: 39,217,728	V124I	possibly damaging	Het
Parp2	T	A	14: 50,819,673	Y361N	probably damaging	Het
Parp3	A	G	9: 106,471,796	F466L	possibly damaging	Het
Pcdh15	A	T	10: 74,290,976	N296Y	probably damaging	Het
Pcf11	G	A	7: 92,657,831	P1043L	probably damaging	Het
Pdzrn3	A	T	6: 101,151,053	I884N	probably damaging	Het
Phf24	G	T	4: 42,933,761	V48L	possibly damaging	Het
Pla2g4a	T	A	1: 149,840,647	M688L	possibly damaging	Het
Plcl2	T	C	17: 50,607,982	L673P	probably damaging	Het
Ppp1r3c	A	T	19: 36,734,217	F51Y	possibly damaging	Het
Prmt1	A	G	7: 44,978,801		probably benign	Het
Proc	G	A	18: 32,125,118	T258I	probably benign	Het
Prom2	T	G	2: 127,531,113	S679R	possibly damaging	Het
Psen2	T	C	1: 180,238,914	T153A	probably damaging	Het
Rem2	T	C	14: 54,476,297		probably benign	Het
Rin2	A	G	2: 145,861,033	K550E	probably benign	Het
Rtn4	T	A	11: 29,733,849		probably benign	Het
Ssh1	A	T	5: 113,946,705	D448E	probably benign	Het
Ssmem1	A	T	6: 30,519,548		probably null	Het
Stam2	A	T	2: 52,719,986		probably benign	Het
Syne1	A	G	10: 5,367,600	L498P	probably damaging	Het
Syne2	AGAGTGAG	AGAGTGAGTGAG	12: 76,097,960		probably null	Het
Taf6l	G	T	19: 8,778,521	H254Q	probably benign	Het
Tas2r123	T	C	6: 132,847,332	V64A	probably benign	Het
Tnnc1	A	G	14: 31,211,408	D149G	probably damaging	Het
Tpp2	A	G	1: 43,999,693	D1133G	probably damaging	Het
Tpp2	T	A	1: 43,978,504	V756E	probably benign	Het
Traf3ip3	T	A	1: 193,178,231		probably null	Het
Tsen15	A	G	1: 152,371,797	V148A	probably damaging	Het
Ttn	T	A	2: 76,864,328		probably benign	Het
Ube2u	A	G	4: 100,486,673	I90V	probably benign	Het
Unc79	T	A	12: 103,079,070		probably null	Het
Usp47	T	C	7: 112,056,580	S155P	possibly damaging	Het
Wdr41	T	C	13: 95,018,111		probably benign	Het
Zfp217	C	T	2: 170,115,462	A539T	probably benign	Het
Zfp423	A	G	8: 87,782,259	S486P	possibly damaging	Het
Zfp628	A	T	7: 4,919,733	Q318L	probably benign	Het

Other mutations in Ahnak

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Ahnak	APN	19	9007223	missense	probably damaging	0.99
IGL00509:Ahnak	APN	19	9009951	missense	possibly damaging	0.94
IGL00539:Ahnak	APN	19	9007908	missense	possibly damaging	0.50
IGL00558:Ahnak	APN	19	9004307	missense	possibly damaging	0.93
IGL00567:Ahnak	APN	19	9013383	missense	probably benign	0.24
IGL00706:Ahnak	APN	19	9013730	nonsense	probably null
IGL00807:Ahnak	APN	19	9008522	missense	possibly damaging	0.92
IGL00870:Ahnak	APN	19	9013698	missense	probably damaging	1.00
IGL01101:Ahnak	APN	19	9012887	intron	probably benign
IGL01118:Ahnak	APN	19	9012578	missense	probably damaging	1.00
IGL01288:Ahnak	APN	19	9002494	missense	possibly damaging	0.94
IGL01324:Ahnak	APN	19	9003032	missense	probably damaging	1.00
IGL01341:Ahnak	APN	19	9011703	missense	probably benign
IGL01541:Ahnak	APN	19	9007879	missense	possibly damaging	0.95
IGL01580:Ahnak	APN	19	9002839	missense	probably benign	0.02
IGL01595:Ahnak	APN	19	9003501	nonsense	probably null
IGL01746:Ahnak	APN	19	9004912	missense	possibly damaging	0.89
IGL01766:Ahnak	APN	19	9000118	missense	unknown
IGL01821:Ahnak	APN	19	9012118	missense	probably benign
IGL01913:Ahnak	APN	19	9006064	nonsense	probably null
IGL01934:Ahnak	APN	19	9002657	missense	probably damaging	1.00
IGL01940:Ahnak	APN	19	9006557	missense	probably benign	0.14
IGL01958:Ahnak	APN	19	9014909	missense	possibly damaging	0.59
IGL02145:Ahnak	APN	19	9002855	missense	probably benign	0.11
IGL02246:Ahnak	APN	19	9008268	missense	probably damaging	1.00
IGL02282:Ahnak	APN	19	9005987	missense	probably damaging	1.00
IGL02428:Ahnak	APN	19	9014833	missense	possibly damaging	0.83
IGL02442:Ahnak	APN	19	9004016	missense	probably damaging	1.00
IGL02474:Ahnak	APN	19	9004933	missense	probably benign	0.13
IGL02483:Ahnak	APN	19	9003308	missense	probably benign	0.01
IGL02616:Ahnak	APN	19	9005627	missense	probably benign	0.03
IGL02630:Ahnak	APN	19	9012077	missense	probably damaging	1.00
IGL02690:Ahnak	APN	19	9012584	nonsense	probably null
IGL02717:Ahnak	APN	19	9002387	missense	probably benign	0.00
IGL02721:Ahnak	APN	19	9009707	missense	probably benign	0.07
IGL02737:Ahnak	APN	19	9004593	missense	probably benign	0.17
IGL02850:Ahnak	APN	19	9002596	missense	probably benign	0.00
IGL03071:Ahnak	APN	19	9011918	missense	possibly damaging	0.63
IGL03072:Ahnak	APN	19	9006508	missense	probably benign	0.11
IGL03094:Ahnak	APN	19	9003547	missense	possibly damaging	0.64
IGL03140:Ahnak	APN	19	9005212	intron	probably benign
IGL03176:Ahnak	APN	19	9008166	missense	possibly damaging	0.56
IGL03176:Ahnak	APN	19	9002449	missense	probably damaging	1.00
IGL03189:Ahnak	APN	19	9011239	missense	possibly damaging	0.65
IGL03357:Ahnak	APN	19	9009325	intron	probably benign
IGL03371:Ahnak	APN	19	9004228	missense	possibly damaging	0.91
Eskimo	UTSW	19	9009574	missense	probably benign	0.31
Nanook	UTSW	19	9003231	missense	probably benign	0.42
Netsilik	UTSW	19	9002321	missense	probably benign	0.00
IGL03097:Ahnak	UTSW	19	9002387	missense	probably benign	0.00
PIT4403001:Ahnak	UTSW	19	9006176	missense	possibly damaging	0.87
R0054:Ahnak	UTSW	19	9012056	missense	probably damaging	1.00
R0094:Ahnak	UTSW	19	9013893	missense	probably benign	0.12
R0141:Ahnak	UTSW	19	9006680	missense	probably damaging	1.00
R0166:Ahnak	UTSW	19	9005725	missense	probably damaging	1.00
R0309:Ahnak	UTSW	19	9002495	missense	probably damaging	1.00
R0368:Ahnak	UTSW	19	9008350	nonsense	probably null
R0386:Ahnak	UTSW	19	9011144	missense	possibly damaging	0.94
R0401:Ahnak	UTSW	19	9015116	missense	probably benign	0.24
R0415:Ahnak	UTSW	19	9012871	intron	probably benign
R0463:Ahnak	UTSW	19	9009407	intron	probably benign
R0469:Ahnak	UTSW	19	9018232	nonsense	probably null
R0470:Ahnak	UTSW	19	9008967	missense	probably benign	0.29
R0487:Ahnak	UTSW	19	9007151	missense	probably benign	0.00
R0487:Ahnak	UTSW	19	9014120	missense	probably damaging	0.99
R0499:Ahnak	UTSW	19	9000264	splice site	probably benign
R0506:Ahnak	UTSW	19	9009128	missense	probably damaging	1.00
R0510:Ahnak	UTSW	19	9018232	nonsense	probably null
R0557:Ahnak	UTSW	19	9001944	missense	probably benign	0.10
R0570:Ahnak	UTSW	19	9013698	missense	probably damaging	1.00
R0610:Ahnak	UTSW	19	9007878	missense	probably benign	0.08
R0646:Ahnak	UTSW	19	9013402	nonsense	probably null
R0659:Ahnak	UTSW	19	9015002	missense	possibly damaging	0.60
R0791:Ahnak	UTSW	19	9016734	missense	probably benign	0.01
R0792:Ahnak	UTSW	19	9016734	missense	probably benign	0.01
R0840:Ahnak	UTSW	19	9005063	missense	probably damaging	1.00
R0847:Ahnak	UTSW	19	9006433	nonsense	probably null
R0941:Ahnak	UTSW	19	9009914	missense	probably damaging	1.00
R0962:Ahnak	UTSW	19	9012848	intron	probably benign
R1017:Ahnak	UTSW	19	9010543	missense	probably damaging	0.99
R1037:Ahnak	UTSW	19	9007618	missense	probably benign	0.27
R1085:Ahnak	UTSW	19	9013125	missense	possibly damaging	0.50
R1113:Ahnak	UTSW	19	9005620	missense	probably benign	0.29
R1140:Ahnak	UTSW	19	9004245	missense	probably damaging	1.00
R1158:Ahnak	UTSW	19	9013926	missense	probably benign	0.00
R1218:Ahnak	UTSW	19	9015619	missense	probably damaging	1.00
R1225:Ahnak	UTSW	19	9002883	missense	probably damaging	1.00
R1245:Ahnak	UTSW	19	9004169	missense	probably benign	0.44
R1421:Ahnak	UTSW	19	9015631	missense	possibly damaging	0.95
R1447:Ahnak	UTSW	19	9007082	missense	probably damaging	0.98
R1464:Ahnak	UTSW	19	9004896	missense	probably damaging	1.00
R1464:Ahnak	UTSW	19	9004896	missense	probably damaging	1.00
R1466:Ahnak	UTSW	19	9015875	missense	probably damaging	1.00
R1466:Ahnak	UTSW	19	9015875	missense	probably damaging	1.00
R1471:Ahnak	UTSW	19	9012932	intron	probably benign
R1507:Ahnak	UTSW	19	9010077	missense	probably damaging	1.00
R1521:Ahnak	UTSW	19	9004728	missense	probably benign	0.11
R1568:Ahnak	UTSW	19	9002375	missense	probably damaging	0.98
R1569:Ahnak	UTSW	19	9004094	missense	possibly damaging	0.78
R1616:Ahnak	UTSW	19	9008987	missense	possibly damaging	0.94
R1638:Ahnak	UTSW	19	9009449	missense	probably benign	0.01
R1680:Ahnak	UTSW	19	9009963	missense	probably benign	0.05
R1713:Ahnak	UTSW	19	9011809	missense	possibly damaging	0.95
R1722:Ahnak	UTSW	19	9010655	missense	probably damaging	0.99
R1771:Ahnak	UTSW	19	9013753	missense	probably benign	0.24
R1795:Ahnak	UTSW	19	9002438	missense	possibly damaging	0.79
R1823:Ahnak	UTSW	19	9004905	missense	probably damaging	0.99
R1842:Ahnak	UTSW	19	9005867	missense	probably damaging	0.99
R1854:Ahnak	UTSW	19	9013832	missense	possibly damaging	0.61
R1856:Ahnak	UTSW	19	9002048	missense	possibly damaging	0.86
R1886:Ahnak	UTSW	19	9015979	missense	probably damaging	0.98
R1888:Ahnak	UTSW	19	9007088	missense	probably damaging	1.00
R1888:Ahnak	UTSW	19	9007088	missense	probably damaging	1.00
R1912:Ahnak	UTSW	19	9017881	missense	probably damaging	1.00
R1913:Ahnak	UTSW	19	9007922	missense	probably damaging	0.99
R1942:Ahnak	UTSW	19	9015083	missense	probably damaging	0.98
R1987:Ahnak	UTSW	19	9015251	missense	probably damaging	1.00
R2006:Ahnak	UTSW	19	9007075	missense	probably damaging	1.00
R2013:Ahnak	UTSW	19	9014573	missense	probably damaging	0.98
R2014:Ahnak	UTSW	19	9013181	missense	probably damaging	0.99
R2047:Ahnak	UTSW	19	9014300	missense	possibly damaging	0.67
R2048:Ahnak	UTSW	19	9007056	missense	probably damaging	0.99
R2060:Ahnak	UTSW	19	9008041	missense	probably benign	0.08
R2083:Ahnak	UTSW	19	9011557	missense	probably damaging	1.00
R2157:Ahnak	UTSW	19	9000684	missense	possibly damaging	0.92
R2167:Ahnak	UTSW	19	9011494	nonsense	probably null
R2208:Ahnak	UTSW	19	9017732	missense	probably benign	0.00
R2224:Ahnak	UTSW	19	9012991	intron	probably benign
R2268:Ahnak	UTSW	19	9010574	missense	possibly damaging	0.66
R2420:Ahnak	UTSW	19	9009256	missense	possibly damaging	0.89
R2426:Ahnak	UTSW	19	9002851	missense	possibly damaging	0.81
R2910:Ahnak	UTSW	19	9011654	missense	probably damaging	0.99
R2911:Ahnak	UTSW	19	9011654	missense	probably damaging	0.99
R2981:Ahnak	UTSW	19	9000148	missense	probably damaging	0.97
R3151:Ahnak	UTSW	19	9009944	missense	probably benign	0.12
R3155:Ahnak	UTSW	19	9010177	missense	possibly damaging	0.49
R3422:Ahnak	UTSW	19	9005708	missense	probably benign	0.39
R3422:Ahnak	UTSW	19	9006752	missense	probably benign	0.05
R3430:Ahnak	UTSW	19	9006958	missense	probably benign	0.42
R3433:Ahnak	UTSW	19	9009994	missense	probably benign	0.01
R3711:Ahnak	UTSW	19	9007898	missense	probably benign
R3723:Ahnak	UTSW	19	9016853	missense	possibly damaging	0.79
R3775:Ahnak	UTSW	19	9009023	missense	possibly damaging	0.91
R3858:Ahnak	UTSW	19	9010859	missense	possibly damaging	0.82
R3859:Ahnak	UTSW	19	9010859	missense	possibly damaging	0.82
R3922:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R3924:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R3926:Ahnak	UTSW	19	9006328	missense	probably benign	0.20
R4026:Ahnak	UTSW	19	9011299	missense	probably damaging	0.97
R4051:Ahnak	UTSW	19	9014327	missense	probably damaging	1.00
R4209:Ahnak	UTSW	19	9002600	missense	probably damaging	1.00
R4234:Ahnak	UTSW	19	9000786	nonsense	probably null
R4237:Ahnak	UTSW	19	9001783	missense	probably benign	0.02
R4285:Ahnak	UTSW	19	9016839	nonsense	probably null
R4331:Ahnak	UTSW	19	9015820	missense	probably damaging	1.00
R4342:Ahnak	UTSW	19	9012083	missense	possibly damaging	0.79
R4430:Ahnak	UTSW	19	9003040	missense	probably benign	0.00
R4554:Ahnak	UTSW	19	9014930	missense	probably damaging	1.00
R4602:Ahnak	UTSW	19	9010825	missense	possibly damaging	0.66
R4612:Ahnak	UTSW	19	9003724	missense	probably benign	0.44
R4655:Ahnak	UTSW	19	9008701	missense	probably damaging	1.00
R4656:Ahnak	UTSW	19	9004855	missense	possibly damaging	0.80
R4700:Ahnak	UTSW	19	9004681	missense	probably benign	0.02
R4704:Ahnak	UTSW	19	9012258	intron	probably benign
R4704:Ahnak	UTSW	19	9013181	missense	probably damaging	0.99
R4705:Ahnak	UTSW	19	9016906	missense	probably benign	0.07
R4707:Ahnak	UTSW	19	9016735	missense	probably benign	0.03
R4732:Ahnak	UTSW	19	9007301	missense	probably damaging	1.00
R4733:Ahnak	UTSW	19	9007301	missense	probably damaging	1.00
R4778:Ahnak	UTSW	19	9011975	missense	possibly damaging	0.79
R4782:Ahnak	UTSW	19	9012499	intron	probably benign
R4832:Ahnak	UTSW	19	9012460	intron	probably benign
R4882:Ahnak	UTSW	19	9005897	missense	probably damaging	0.98
R4884:Ahnak	UTSW	19	9012754	intron	probably benign
R4895:Ahnak	UTSW	19	9017441	missense	probably benign	0.43
R4930:Ahnak	UTSW	19	9010967	missense	possibly damaging	0.79
R4951:Ahnak	UTSW	19	9017835	missense	probably damaging	1.00
R4968:Ahnak	UTSW	19	9015100	missense	probably damaging	1.00
R5026:Ahnak	UTSW	19	9010631	missense	possibly damaging	0.46
R5050:Ahnak	UTSW	19	9012458	intron	probably benign
R5073:Ahnak	UTSW	19	9003231	missense	probably benign	0.42
R5110:Ahnak	UTSW	19	9014759	missense	probably damaging	1.00
R5119:Ahnak	UTSW	19	9013644	missense	probably benign	0.00
R5128:Ahnak	UTSW	19	9017087	missense	probably damaging	1.00
R5139:Ahnak	UTSW	19	9004655	missense	probably damaging	1.00
R5150:Ahnak	UTSW	19	9010904	missense	possibly damaging	0.46
R5151:Ahnak	UTSW	19	9017569	missense	probably benign	0.03
R5165:Ahnak	UTSW	19	9015665	missense	possibly damaging	0.95
R5236:Ahnak	UTSW	19	9000684	missense	possibly damaging	0.92
R5361:Ahnak	UTSW	19	9015341	missense	possibly damaging	0.92
R5366:Ahnak	UTSW	19	9016735	missense	possibly damaging	0.65
R5387:Ahnak	UTSW	19	9003691	missense	probably damaging	1.00
R5396:Ahnak	UTSW	19	9007175	missense	probably damaging	0.99
R5583:Ahnak	UTSW	19	9006917	missense	probably damaging	0.99
R5587:Ahnak	UTSW	19	9009476	missense	possibly damaging	0.88
R5620:Ahnak	UTSW	19	9013094	nonsense	probably null
R5643:Ahnak	UTSW	19	9010657	missense	possibly damaging	0.66
R5644:Ahnak	UTSW	19	9010657	missense	possibly damaging	0.66
R5657:Ahnak	UTSW	19	9014615	missense	probably damaging	0.99
R5688:Ahnak	UTSW	19	9002519	missense	probably benign	0.01
R5702:Ahnak	UTSW	19	9001840	missense	probably damaging	1.00
R5727:Ahnak	UTSW	19	9016747	missense	probably damaging	0.99
R5730:Ahnak	UTSW	19	9010253	missense	possibly damaging	0.81
R5755:Ahnak	UTSW	19	9001732	missense	probably benign	0.06
R5760:Ahnak	UTSW	19	9013562	missense	probably damaging	1.00
R5789:Ahnak	UTSW	19	9002321	missense	probably benign	0.00
R5790:Ahnak	UTSW	19	9015248	missense	probably damaging	0.99
R5795:Ahnak	UTSW	19	9012382	nonsense	probably null
R5808:Ahnak	UTSW	19	9010235	missense	possibly damaging	0.91
R5867:Ahnak	UTSW	19	9010052	missense	probably damaging	0.99
R5878:Ahnak	UTSW	19	9008342	missense	probably damaging	1.00
R5898:Ahnak	UTSW	19	9013767	missense	possibly damaging	0.63
R5898:Ahnak	UTSW	19	9018211	missense	probably damaging	1.00
R5912:Ahnak	UTSW	19	9011903	missense	probably damaging	0.99
R5935:Ahnak	UTSW	19	9015182	missense	possibly damaging	0.91
R5969:Ahnak	UTSW	19	9016585	missense	probably damaging	1.00
R5988:Ahnak	UTSW	19	9009347	intron	probably benign
R6000:Ahnak	UTSW	19	9013111	nonsense	probably null
R6005:Ahnak	UTSW	19	9015161	missense	possibly damaging	0.61
R6101:Ahnak	UTSW	19	9004099	missense	probably benign	0.20
R6105:Ahnak	UTSW	19	9004099	missense	probably benign	0.20
R6116:Ahnak	UTSW	19	9012963	intron	probably benign
R6209:Ahnak	UTSW	19	9012566	missense	probably damaging	1.00
R6240:Ahnak	UTSW	19	9013583	missense	probably damaging	1.00
R6255:Ahnak	UTSW	19	9008025	missense	possibly damaging	0.95
R6263:Ahnak	UTSW	19	9018277	missense	probably benign	0.03
R6287:Ahnak	UTSW	19	9015003	missense	probably benign	0.02
R6296:Ahnak	UTSW	19	9003305	missense	probably damaging	0.99
R6315:Ahnak	UTSW	19	9006626	missense	probably damaging	0.99
R6328:Ahnak	UTSW	19	9007148	missense	probably benign	0.11
R6331:Ahnak	UTSW	19	9006625	missense	probably benign	0.18
R6355:Ahnak	UTSW	19	9008762	missense	probably benign	0.02
R6409:Ahnak	UTSW	19	9009574	missense	probably benign	0.31
R6567:Ahnak	UTSW	19	9008806	missense	probably benign	0.27
R6572:Ahnak	UTSW	19	9007976	missense	probably damaging	0.99
R6574:Ahnak	UTSW	19	9017047	missense	probably benign	0.04
R6590:Ahnak	UTSW	19	9009581	missense	probably benign	0.29
R6620:Ahnak	UTSW	19	9015310	missense	possibly damaging	0.95
R6690:Ahnak	UTSW	19	9009581	missense	probably benign	0.29
R6731:Ahnak	UTSW	19	9011562	missense	possibly damaging	0.85
R6756:Ahnak	UTSW	19	9007561	missense	possibly damaging	0.59
R6846:Ahnak	UTSW	19	9011857	missense	possibly damaging	0.66
R6854:Ahnak	UTSW	19	9015235	missense	probably damaging	1.00
R6857:Ahnak	UTSW	19	9037168	nonsense	probably null
R6863:Ahnak	UTSW	19	9012365	intron	probably benign
R6876:Ahnak	UTSW	19	9014120	missense	probably damaging	0.99
R6958:Ahnak	UTSW	19	9015215	missense	possibly damaging	0.88
R7126:Ahnak	UTSW	19	9002359	missense	possibly damaging	0.61
R7181:Ahnak	UTSW	19	9013488	missense	probably damaging	1.00
R7183:Ahnak	UTSW	19	9017668	missense	probably damaging	1.00
R7202:Ahnak	UTSW	19	9017799	missense	probably damaging	1.00
R7235:Ahnak	UTSW	19	9012488	missense	unknown
R7241:Ahnak	UTSW	19	9009031	missense	possibly damaging	0.65
R7269:Ahnak	UTSW	19	9006617	missense	probably damaging	1.00
R7311:Ahnak	UTSW	19	9002143	missense	probably benign	0.04
R7311:Ahnak	UTSW	19	9009827	missense	possibly damaging	0.56
R7329:Ahnak	UTSW	19	9001792	missense	probably damaging	0.99
R7339:Ahnak	UTSW	19	9008165	missense	possibly damaging	0.75
R7390:Ahnak	UTSW	19	9003205	missense	probably benign	0.02
R7400:Ahnak	UTSW	19	9014613	missense	probably damaging	0.99
R7444:Ahnak	UTSW	19	9007423	missense	probably benign	0.08
R7483:Ahnak	UTSW	19	9004822	missense	probably damaging	1.00
R7498:Ahnak	UTSW	19	9012019	missense	probably benign	0.14
R7521:Ahnak	UTSW	19	9002351	missense	possibly damaging	0.89
R7522:Ahnak	UTSW	19	9002322	missense	probably benign	0.01
R7552:Ahnak	UTSW	19	9006824	missense	probably benign	0.18
R7563:Ahnak	UTSW	19	9011165	missense	probably damaging	0.99
R7565:Ahnak	UTSW	19	9016156	missense	probably benign	0.05
R7571:Ahnak	UTSW	19	9000786	nonsense	probably null
R7583:Ahnak	UTSW	19	9006093	missense	possibly damaging	0.90
R7600:Ahnak	UTSW	19	9004574	missense	possibly damaging	0.89
R7771:Ahnak	UTSW	19	9015047	missense	probably damaging	0.99
R7787:Ahnak	UTSW	19	9009315	missense	unknown
R7827:Ahnak	UTSW	19	9005344	nonsense	probably null
R7857:Ahnak	UTSW	19	9007468	missense	probably damaging	0.97
R7916:Ahnak	UTSW	19	9005832	missense	possibly damaging	0.66
R7939:Ahnak	UTSW	19	9014084	nonsense	probably null
R7959:Ahnak	UTSW	19	9010649	missense	possibly damaging	0.46
R7962:Ahnak	UTSW	19	9012800	missense	unknown
R7979:Ahnak	UTSW	19	9011432	missense	probably damaging	1.00
R8006:Ahnak	UTSW	19	9012083	missense	possibly damaging	0.79
R8013:Ahnak	UTSW	19	9009335	missense	unknown
R8033:Ahnak	UTSW	19	9003710	missense	probably benign	0.10
R8124:Ahnak	UTSW	19	9007123	missense	probably damaging	0.99
R8125:Ahnak	UTSW	19	9011876	missense	possibly damaging	0.95
R8129:Ahnak	UTSW	19	9000100	start codon destroyed	not run
R8151:Ahnak	UTSW	19	9004679	missense	possibly damaging	0.59
R8190:Ahnak	UTSW	19	9002255	missense	probably benign	0.01
R8221:Ahnak	UTSW	19	9010436	nonsense	probably null
R8241:Ahnak	UTSW	19	9007295	missense	probably benign	0.15
R8244:Ahnak	UTSW	19	9015673	missense	probably benign	0.44
R8248:Ahnak	UTSW	19	9001946	missense	probably damaging	1.00
R8261:Ahnak	UTSW	19	9005453	missense	probably damaging	1.00
R8330:Ahnak	UTSW	19	9009662	missense	possibly damaging	0.86
R8380:Ahnak	UTSW	19	9017855	missense	probably benign	0.05
R8407:Ahnak	UTSW	19	9015673	missense	probably benign	0.44
R8409:Ahnak	UTSW	19	9015673	missense	probably benign	0.44
R8463:Ahnak	UTSW	19	9008749	missense	probably benign	0.07
R8511:Ahnak	UTSW	19	9012355	missense	unknown
R8528:Ahnak	UTSW	19	9007728	missense	probably damaging	1.00
R8549:Ahnak	UTSW	19	9011483	missense	probably damaging	1.00
R8674:Ahnak	UTSW	19	9005996	missense	probably damaging	0.98
R8716:Ahnak	UTSW	19	9009074	missense	probably damaging	1.00
R8722:Ahnak	UTSW	19	9013346	nonsense	probably null
R8751:Ahnak	UTSW	19	9010145	missense	probably damaging	1.00
R8752:Ahnak	UTSW	19	9015537	missense	probably damaging	1.00
R8783:Ahnak	UTSW	19	9011473	missense	probably damaging	1.00
R8844:Ahnak	UTSW	19	9006890	missense	probably damaging	1.00
R8859:Ahnak	UTSW	19	9007203	missense	probably damaging	1.00
R8882:Ahnak	UTSW	19	9000742	missense	probably damaging	1.00
R8907:Ahnak	UTSW	19	9009088	missense	probably benign	0.24
R8938:Ahnak	UTSW	19	9011735	missense	probably benign	0.00
R8975:Ahnak	UTSW	19	9012737	missense	probably damaging	1.00
R8983:Ahnak	UTSW	19	9004113	missense	possibly damaging	0.75
R9017:Ahnak	UTSW	19	9010123	missense	probably damaging	1.00
R9027:Ahnak	UTSW	19	9007253	missense	possibly damaging	0.94
R9081:Ahnak	UTSW	19	9008526	missense	possibly damaging	0.81
R9104:Ahnak	UTSW	19	9010347	missense	probably benign	0.01
R9112:Ahnak	UTSW	19	9009785	missense	probably damaging	0.98
R9145:Ahnak	UTSW	19	9014923	missense	probably benign	0.38
R9189:Ahnak	UTSW	19	9010883	missense	possibly damaging	0.92
R9221:Ahnak	UTSW	19	9012579	missense	probably damaging	1.00
R9261:Ahnak	UTSW	19	9016139	missense	possibly damaging	0.63
R9299:Ahnak	UTSW	19	9012460	intron	probably benign
R9325:Ahnak	UTSW	19	9013893	missense	probably benign	0.12
R9337:Ahnak	UTSW	19	9012460	intron	probably benign
R9340:Ahnak	UTSW	19	9017047	missense	probably benign	0.04
R9351:Ahnak	UTSW	19	9007868	missense	probably damaging	1.00
R9416:Ahnak	UTSW	19	9012902	missense	unknown
R9462:Ahnak	UTSW	19	9003935	missense	probably damaging	0.96
R9469:Ahnak	UTSW	19	9010861	missense	probably damaging	1.00
R9485:Ahnak	UTSW	19	9002074	missense	probably benign	0.16
R9503:Ahnak	UTSW	19	9010094	missense	probably damaging	1.00
R9524:Ahnak	UTSW	19	9037253	missense
R9534:Ahnak	UTSW	19	9003612	missense	probably benign	0.20
R9598:Ahnak	UTSW	19	9003785	missense	probably benign	0.42
R9611:Ahnak	UTSW	19	9011798	missense	probably damaging	0.99
R9624:Ahnak	UTSW	19	9012482	missense	unknown
R9649:Ahnak	UTSW	19	9008422	nonsense	probably null
R9683:Ahnak	UTSW	19	9007355	missense	possibly damaging	0.94
R9691:Ahnak	UTSW	19	9011726	missense	possibly damaging	0.49
R9712:Ahnak	UTSW	19	9007028	small deletion	probably benign
R9712:Ahnak	UTSW	19	9007029	small deletion	probably benign
R9713:Ahnak	UTSW	19	9007029	small deletion	probably benign
R9715:Ahnak	UTSW	19	9007029	small deletion	probably benign
R9725:Ahnak	UTSW	19	9004169	missense	probably benign	0.44
R9725:Ahnak	UTSW	19	9014243	missense	probably damaging	1.00
R9747:Ahnak	UTSW	19	9010177	missense	possibly damaging	0.49
R9798:Ahnak	UTSW	19	9013619	missense	probably damaging	0.99
RF007:Ahnak	UTSW	19	9013601	missense	possibly damaging	0.45
X0021:Ahnak	UTSW	19	9013619	missense	probably damaging	0.99
X0027:Ahnak	UTSW	19	9012037	missense	probably damaging	1.00
Z1088:Ahnak	UTSW	19	9016082	missense	probably damaging	0.99
Z1176:Ahnak	UTSW	19	9008856	missense	probably damaging	0.97
Z1177:Ahnak	UTSW	19	9017468	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCGCTCCAACTCCTTCAGTGATG -3'
(R):5'- AGCCTACAGGCACTTGGTTTGTCG -3'

Sequencing Primer
(F):5'- CACCCCAACTGGGACTTTG -3'
(R):5'- TCGGCACTTGCCACTGG -3'

Posted On

2013-04-11