Incidental Mutation 'R1775:Serpinc1'
ID204280
Institutional Source Beutler Lab
Gene Symbol Serpinc1
Ensembl Gene ENSMUSG00000026715
Gene Nameserine (or cysteine) peptidase inhibitor, clade C (antithrombin), member 1
SynonymsAt3, At-3, antithrombin, ATIII
MMRRC Submission 039806-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1775 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location160978585-161005863 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 160989647 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 104 (N104D)
Ref Sequence ENSEMBL: ENSMUSP00000141864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064725] [ENSMUST00000191936] [ENSMUST00000194592] [ENSMUST00000195438] [ENSMUST00000195760]
Predicted Effect probably benign
Transcript: ENSMUST00000064725
AA Change: N104D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068971
Gene: ENSMUSG00000026715
AA Change: N104D

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
SERPIN 93 462 5.55e-173 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191936
SMART Domains Protein: ENSMUSP00000142122
Gene: ENSMUSG00000026715

DomainStartEndE-ValueType
Pfam:Serpin 1 91 2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194455
Predicted Effect probably benign
Transcript: ENSMUST00000194592
AA Change: N104D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141556
Gene: ENSMUSG00000026715
AA Change: N104D

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
SERPIN 93 286 8.3e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194777
Predicted Effect probably benign
Transcript: ENSMUST00000195438
SMART Domains Protein: ENSMUSP00000141834
Gene: ENSMUSG00000026715

DomainStartEndE-ValueType
Pfam:Serpin 1 97 1.1e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195760
AA Change: N104D

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141864
Gene: ENSMUSG00000026715
AA Change: N104D

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Blast:SERPIN 32 107 5e-43 BLAST
PDB:2GD4|C 32 107 3e-43 PDB
SCOP:d1e05i_ 35 107 4e-26 SMART
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a plasma protease inhibitor and a member of the serpin superfamily. This protein inhibits thrombin as well as other activated serine proteases of the coagulation system, and it regulates the blood coagulation cascade. The protein includes two functional domains: the heparin binding-domain at the N-terminus of the mature protein, and the reactive site domain at the C-terminus. The inhibitory activity is enhanced by the presence of heparin. More than 120 mutations have been identified for this gene, many of which are known to cause antithrombin-III deficiency. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit extensive subcutaneous hemorrhage, fibrin deposits in the myocardium and liver, and lethality by embryonic day 16.5. Heterozygotes challenged with lipopolysaccharide show increased fibrin deposits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J04Rik A G 12: 11,222,142 S20P unknown Het
4921528I07Rik G A 9: 114,279,318 noncoding transcript Het
4930562C15Rik G A 16: 4,851,558 probably null Het
4933427I04Rik A G 4: 123,860,493 T67A possibly damaging Het
Abcc2 A T 19: 43,798,419 N160Y possibly damaging Het
Acaca A G 11: 84,300,422 D155G possibly damaging Het
Afg3l1 G A 8: 123,492,900 R389Q possibly damaging Het
Ank2 G A 3: 126,934,547 T799M probably benign Het
Anxa2 T C 9: 69,488,081 Y202H possibly damaging Het
Arhgef33 A G 17: 80,373,743 T771A probably benign Het
Atp12a T C 14: 56,372,589 V182A probably benign Het
Birc6 T C 17: 74,612,286 L210S probably damaging Het
Car3 A G 3: 14,864,432 T73A probably benign Het
Cd5l T C 3: 87,368,659 L312P probably damaging Het
Celf5 A G 10: 81,467,304 probably benign Het
Cep290 T A 10: 100,496,810 V257E probably damaging Het
Cntrob T C 11: 69,320,867 D177G possibly damaging Het
Copg2 A T 6: 30,810,336 F658I probably damaging Het
Csmd3 T C 15: 47,899,739 T1234A probably damaging Het
Dhx35 A G 2: 158,806,437 T72A probably damaging Het
Dmrtc2 A T 7: 24,874,367 H209L possibly damaging Het
Eml5 G T 12: 98,852,704 probably null Het
Evpl T C 11: 116,223,660 E1068G possibly damaging Het
Ezh2 A G 6: 47,576,660 M41T probably damaging Het
Fmo3 A G 1: 162,968,725 S93P possibly damaging Het
Gdi2 A G 13: 3,560,018 Y213C possibly damaging Het
Gpr15 A T 16: 58,718,558 I56K probably benign Het
Gria2 G T 3: 80,691,338 S796R probably benign Het
Hectd4 T A 5: 121,291,191 probably benign Het
Hgfac T C 5: 35,042,850 probably benign Het
Hspg2 C T 4: 137,520,156 R1200W probably damaging Het
Ift52 G A 2: 163,025,355 D78N possibly damaging Het
Iqca C A 1: 90,081,416 W415L probably damaging Het
Ism1 A T 2: 139,746,043 K236N probably damaging Het
Itgb6 C T 2: 60,672,644 W43* probably null Het
Kcnk18 T A 19: 59,235,341 I306N probably damaging Het
Kctd8 T C 5: 69,340,560 K248E probably damaging Het
Layn T A 9: 51,059,533 I237F probably benign Het
Lce3f C T 3: 92,992,941 P23L unknown Het
Lct A G 1: 128,300,301 F1152L probably damaging Het
Mxra8 T C 4: 155,843,074 I413T probably damaging Het
Nedd9 A G 13: 41,317,962 V187A probably benign Het
Net1 A G 13: 3,887,642 L207P probably damaging Het
Neurod1 G T 2: 79,454,437 P201T probably benign Het
Nlrp1b A G 11: 71,161,821 F927S probably damaging Het
Ntrk3 T A 7: 78,356,041 H524L possibly damaging Het
Nup98 A C 7: 102,134,937 S1063A probably benign Het
Olfr1036 G A 2: 86,074,760 V7I possibly damaging Het
Olfr1333 T A 4: 118,829,868 M191L probably benign Het
Olfr1447 C A 19: 12,901,235 V182F probably benign Het
Olfr215 T C 6: 116,582,964 probably benign Het
Olfr657 G A 7: 104,636,159 V162I probably benign Het
Olfr747 G T 14: 50,681,166 P156Q possibly damaging Het
Pdzd2 G A 15: 12,592,460 R33W probably damaging Het
Phf21a G A 2: 92,330,515 V243I probably damaging Het
Ppp1r12b A G 1: 134,893,348 probably null Het
Rexo5 T C 7: 119,845,411 V703A probably benign Het
Rgs4 A G 1: 169,745,278 S30P probably benign Het
Rrnad1 A G 3: 87,923,817 S404P probably damaging Het
Rxra C A 2: 27,756,244 D340E probably damaging Het
Samhd1 A G 2: 157,107,547 V473A probably benign Het
Scn3a T A 2: 65,472,342 K1253N probably damaging Het
Scn7a T C 2: 66,680,955 N1207S probably benign Het
Sec24d T A 3: 123,336,517 I443N probably damaging Het
Sema4g T A 19: 44,999,242 probably null Het
Sema5b A G 16: 35,660,324 K787R probably benign Het
Sfn T C 4: 133,601,231 H180R probably damaging Het
Slc22a6 G T 19: 8,619,107 probably null Het
Slc9a8 T C 2: 167,457,358 S217P probably benign Het
Smc6 A G 12: 11,309,269 N965D probably benign Het
Sod2 T A 17: 13,015,032 I177N probably damaging Het
Sp4 A T 12: 118,299,600 I237K probably damaging Het
Sulf2 T C 2: 166,079,612 K697R probably benign Het
Svs4 A T 2: 164,277,085 D110E unknown Het
Tas1r1 T A 4: 152,038,218 R57* probably null Het
Tlr5 T C 1: 182,973,722 I197T probably damaging Het
Tmc3 T C 7: 83,612,532 V606A probably benign Het
Tmem241 T A 18: 12,118,412 L37F probably damaging Het
Tmem59l A T 8: 70,486,253 N90K probably damaging Het
Tram1 A C 1: 13,576,456 probably benign Het
Trim15 T A 17: 36,865,169 H162L probably benign Het
Ttc28 T A 5: 111,276,811 Y1501N probably benign Het
Ttc34 T C 4: 154,862,214 V857A probably benign Het
Tulp4 A G 17: 6,139,046 T48A probably damaging Het
Usp9y T C Y: 1,368,089 E939G probably damaging Het
Utp20 A G 10: 88,770,808 I1634T probably benign Het
Vmn2r72 T C 7: 85,738,170 M729V probably benign Het
Vps13c C T 9: 67,881,447 T334M probably damaging Het
Wnk4 C G 11: 101,276,340 probably benign Het
Xpo1 A G 11: 23,271,193 N97D probably benign Het
Xpo4 A T 14: 57,603,672 F518Y probably benign Het
Zfp668 C T 7: 127,866,606 V469I possibly damaging Het
Zfp85 C A 13: 67,749,704 C83F probably damaging Het
Other mutations in Serpinc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Serpinc1 APN 1 160993400 missense probably damaging 1.00
IGL01923:Serpinc1 APN 1 160989546 missense probably damaging 0.98
IGL01987:Serpinc1 APN 1 160993407 missense probably damaging 1.00
IGL02272:Serpinc1 APN 1 160999992 missense probably damaging 1.00
IGL02574:Serpinc1 APN 1 161002459 missense probably benign 0.00
IGL02730:Serpinc1 APN 1 161000028 missense probably damaging 0.97
IGL02861:Serpinc1 APN 1 160999991 missense probably damaging 0.99
IGL03377:Serpinc1 APN 1 160993442 missense probably damaging 1.00
R0277:Serpinc1 UTSW 1 160989702 start codon destroyed probably null 1.00
R1294:Serpinc1 UTSW 1 160989641 missense probably damaging 0.98
R1368:Serpinc1 UTSW 1 160993524 missense probably damaging 1.00
R1433:Serpinc1 UTSW 1 160993404 missense probably damaging 0.97
R1436:Serpinc1 UTSW 1 160993411 missense possibly damaging 0.63
R1480:Serpinc1 UTSW 1 160995319 missense probably benign 0.00
R1703:Serpinc1 UTSW 1 160993517 missense probably damaging 1.00
R2007:Serpinc1 UTSW 1 160993540 missense probably benign 0.05
R3757:Serpinc1 UTSW 1 161002365 missense probably benign 0.00
R5134:Serpinc1 UTSW 1 160997570 unclassified probably null
R5252:Serpinc1 UTSW 1 160989621 missense probably damaging 1.00
R7033:Serpinc1 UTSW 1 160997521 missense probably benign 0.04
R7254:Serpinc1 UTSW 1 160993618 missense probably benign 0.01
R7262:Serpinc1 UTSW 1 160989659 missense probably damaging 1.00
R7429:Serpinc1 UTSW 1 160995441 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACGACATCTGCATAGCGAAG -3'
(R):5'- AGTGAGATCCCCTAGACGAG -3'

Sequencing Primer
(F):5'- CGAAGCCCCGAGACATC -3'
(R):5'- AGGAAGAGGGCTTTACAC -3'
Posted On2014-06-23