Mutagenetix > Incidental Mutation

Incidental Mutation 'R1775:Rxra'

204284

Institutional Source

Beutler Lab

Gene Symbol

Rxra

Ensembl Gene

ENSMUSG00000015846

Gene Name

retinoid X receptor alpha

Synonyms

RXRalpha1, RXR alpha 1, 9530071D11Rik

MMRRC Submission

039806-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1775 (G1)

Quality Score

222

Status

Validated

Chromosome

Chromosomal Location

27676440-27762957 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 27756244 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 340 (D340E)

Ref Sequence

ENSEMBL: ENSMUSP00000109567 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077257] [ENSMUST00000100251] [ENSMUST00000113934] [ENSMUST00000166775]

AlphaFold

P28700

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077257
AA Change: D368E

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000076491
Gene: ENSMUSG00000015846
AA Change: D368E

Domain	Start	End	E-Value	Type
Pfam:Nuc_recep-AF1	18	132	4.2e-42	PFAM
ZnF_C4	137	208	1.76e-40	SMART
Blast:HOLI	233	265	1e-8	BLAST
HOLI	275	434	1.62e-53	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000100251
AA Change: D340E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000097822
Gene: ENSMUSG00000015846
AA Change: D340E

Domain	Start	End	E-Value	Type
Pfam:Nuc_recep-AF1	1	104	1.8e-38	PFAM
ZnF_C4	109	180	1.76e-40	SMART
Blast:HOLI	205	237	1e-8	BLAST
HOLI	247	406	1.62e-53	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000113934
AA Change: D340E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109567
Gene: ENSMUSG00000015846
AA Change: D340E

Domain	Start	End	E-Value	Type
Pfam:Nuc_recep-AF1	1	104	1.8e-38	PFAM
ZnF_C4	109	180	1.76e-40	SMART
Blast:HOLI	205	237	1e-8	BLAST
HOLI	247	406	1.62e-53	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166775
AA Change: D368E

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000133044
Gene: ENSMUSG00000015846
AA Change: D368E

Domain	Start	End	E-Value	Type
Pfam:Nuc_recep-AF1	17	132	6.5e-41	PFAM
ZnF_C4	137	208	1.76e-40	SMART
Blast:HOLI	233	265	1e-8	BLAST
HOLI	275	434	1.62e-53	SMART

Meta Mutation Damage Score

0.5483

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 92.9%

Validation Efficiency

98% (95/97)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Retinoid X receptors (RXRs) and retinoic acid receptors (RARs) are nuclear receptors that mediate the biological effects of retinoids by their involvement in retinoic acid-mediated gene activation. These receptors function as transcription factors by binding as homodimers or heterodimers to specific sequences in the promoters of target genes. The protein encoded by this gene is a member of the steroid and thyroid hormone receptor superfamily of transcriptional regulators. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Null embryos have multiple organ defects and die of cardiac failure by E14.5. Gene ablation in liver, prostate, fat or epidermis tissue-specifically affects development, function and/or neoplasia. Hypomorphic mutants develop alopecia, progressively severe dermal cysts and late corneal opacity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034J04Rik	A	G	12: 11,222,142	S20P	unknown	Het
4921528I07Rik	G	A	9: 114,279,318		noncoding transcript	Het
4930562C15Rik	G	A	16: 4,851,558		probably null	Het
4933427I04Rik	A	G	4: 123,860,493	T67A	possibly damaging	Het
Abcc2	A	T	19: 43,798,419	N160Y	possibly damaging	Het
Acaca	A	G	11: 84,300,422	D155G	possibly damaging	Het
Afg3l1	G	A	8: 123,492,900	R389Q	possibly damaging	Het
Ank2	G	A	3: 126,934,547	T799M	probably benign	Het
Anxa2	T	C	9: 69,488,081	Y202H	possibly damaging	Het
Arhgef33	A	G	17: 80,373,743	T771A	probably benign	Het
Atp12a	T	C	14: 56,372,589	V182A	probably benign	Het
Birc6	T	C	17: 74,612,286	L210S	probably damaging	Het
Car3	A	G	3: 14,864,432	T73A	probably benign	Het
Cd5l	T	C	3: 87,368,659	L312P	probably damaging	Het
Celf5	A	G	10: 81,467,304		probably benign	Het
Cep290	T	A	10: 100,496,810	V257E	probably damaging	Het
Cntrob	T	C	11: 69,320,867	D177G	possibly damaging	Het
Copg2	A	T	6: 30,810,336	F658I	probably damaging	Het
Csmd3	T	C	15: 47,899,739	T1234A	probably damaging	Het
Dhx35	A	G	2: 158,806,437	T72A	probably damaging	Het
Dmrtc2	A	T	7: 24,874,367	H209L	possibly damaging	Het
Eml5	G	T	12: 98,852,704		probably null	Het
Evpl	T	C	11: 116,223,660	E1068G	possibly damaging	Het
Ezh2	A	G	6: 47,576,660	M41T	probably damaging	Het
Fmo3	A	G	1: 162,968,725	S93P	possibly damaging	Het
Gdi2	A	G	13: 3,560,018	Y213C	possibly damaging	Het
Gpr15	A	T	16: 58,718,558	I56K	probably benign	Het
Gria2	G	T	3: 80,691,338	S796R	probably benign	Het
Hectd4	T	A	5: 121,291,191		probably benign	Het
Hgfac	T	C	5: 35,042,850		probably benign	Het
Hspg2	C	T	4: 137,520,156	R1200W	probably damaging	Het
Ift52	G	A	2: 163,025,355	D78N	possibly damaging	Het
Iqca	C	A	1: 90,081,416	W415L	probably damaging	Het
Ism1	A	T	2: 139,746,043	K236N	probably damaging	Het
Itgb6	C	T	2: 60,672,644	W43*	probably null	Het
Kcnk18	T	A	19: 59,235,341	I306N	probably damaging	Het
Kctd8	T	C	5: 69,340,560	K248E	probably damaging	Het
Layn	T	A	9: 51,059,533	I237F	probably benign	Het
Lce3f	C	T	3: 92,992,941	P23L	unknown	Het
Lct	A	G	1: 128,300,301	F1152L	probably damaging	Het
Mxra8	T	C	4: 155,843,074	I413T	probably damaging	Het
Nedd9	A	G	13: 41,317,962	V187A	probably benign	Het
Net1	A	G	13: 3,887,642	L207P	probably damaging	Het
Neurod1	G	T	2: 79,454,437	P201T	probably benign	Het
Nlrp1b	A	G	11: 71,161,821	F927S	probably damaging	Het
Ntrk3	T	A	7: 78,356,041	H524L	possibly damaging	Het
Nup98	A	C	7: 102,134,937	S1063A	probably benign	Het
Olfr1036	G	A	2: 86,074,760	V7I	possibly damaging	Het
Olfr1333	T	A	4: 118,829,868	M191L	probably benign	Het
Olfr1447	C	A	19: 12,901,235	V182F	probably benign	Het
Olfr215	T	C	6: 116,582,964		probably benign	Het
Olfr657	G	A	7: 104,636,159	V162I	probably benign	Het
Olfr747	G	T	14: 50,681,166	P156Q	possibly damaging	Het
Pdzd2	G	A	15: 12,592,460	R33W	probably damaging	Het
Phf21a	G	A	2: 92,330,515	V243I	probably damaging	Het
Ppp1r12b	A	G	1: 134,893,348		probably null	Het
Rexo5	T	C	7: 119,845,411	V703A	probably benign	Het
Rgs4	A	G	1: 169,745,278	S30P	probably benign	Het
Rrnad1	A	G	3: 87,923,817	S404P	probably damaging	Het
Samhd1	A	G	2: 157,107,547	V473A	probably benign	Het
Scn3a	T	A	2: 65,472,342	K1253N	probably damaging	Het
Scn7a	T	C	2: 66,680,955	N1207S	probably benign	Het
Sec24d	T	A	3: 123,336,517	I443N	probably damaging	Het
Sema4g	T	A	19: 44,999,242		probably null	Het
Sema5b	A	G	16: 35,660,324	K787R	probably benign	Het
Serpinc1	A	G	1: 160,989,647	N104D	probably benign	Het
Sfn	T	C	4: 133,601,231	H180R	probably damaging	Het
Slc22a6	G	T	19: 8,619,107		probably null	Het
Slc9a8	T	C	2: 167,457,358	S217P	probably benign	Het
Smc6	A	G	12: 11,309,269	N965D	probably benign	Het
Sod2	T	A	17: 13,015,032	I177N	probably damaging	Het
Sp4	A	T	12: 118,299,600	I237K	probably damaging	Het
Sulf2	T	C	2: 166,079,612	K697R	probably benign	Het
Svs4	A	T	2: 164,277,085	D110E	unknown	Het
Tas1r1	T	A	4: 152,038,218	R57*	probably null	Het
Tlr5	T	C	1: 182,973,722	I197T	probably damaging	Het
Tmc3	T	C	7: 83,612,532	V606A	probably benign	Het
Tmem241	T	A	18: 12,118,412	L37F	probably damaging	Het
Tmem59l	A	T	8: 70,486,253	N90K	probably damaging	Het
Tram1	A	C	1: 13,576,456		probably benign	Het
Trim15	T	A	17: 36,865,169	H162L	probably benign	Het
Ttc28	T	A	5: 111,276,811	Y1501N	probably benign	Het
Ttc34	T	C	4: 154,862,214	V857A	probably benign	Het
Tulp4	A	G	17: 6,139,046	T48A	probably damaging	Het
Usp9y	T	C	Y: 1,368,089	E939G	probably damaging	Het
Utp20	A	G	10: 88,770,808	I1634T	probably benign	Het
Vmn2r72	T	C	7: 85,738,170	M729V	probably benign	Het
Vps13c	C	T	9: 67,881,447	T334M	probably damaging	Het
Wnk4	C	G	11: 101,276,340		probably benign	Het
Xpo1	A	G	11: 23,271,193	N97D	probably benign	Het
Xpo4	A	T	14: 57,603,672	F518Y	probably benign	Het
Zfp668	C	T	7: 127,866,606	V469I	possibly damaging	Het
Zfp85	C	A	13: 67,749,704	C83F	probably damaging	Het

Other mutations in Rxra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01941:Rxra	APN	2	27754241	missense	probably damaging	1.00
IGL03006:Rxra	APN	2	27759645	missense	probably damaging	1.00
pinkie	UTSW	2	27752334	missense	probably damaging	0.98
R0265:Rxra	UTSW	2	27752430	missense	probably damaging	1.00
R0578:Rxra	UTSW	2	27759570	missense	probably damaging	1.00
R1555:Rxra	UTSW	2	27748678	missense	probably benign	0.00
R3725:Rxra	UTSW	2	27754277	missense	probably damaging	1.00
R3756:Rxra	UTSW	2	27741911	missense	probably damaging	1.00
R3804:Rxra	UTSW	2	27756260	missense	probably damaging	1.00
R3965:Rxra	UTSW	2	27752306	splice site	probably benign
R4490:Rxra	UTSW	2	27741195	missense	probably damaging	0.99
R4898:Rxra	UTSW	2	27741183	missense	probably damaging	1.00
R5154:Rxra	UTSW	2	27757868	critical splice donor site	probably null
R5651:Rxra	UTSW	2	27737341	missense	probably benign	0.25
R6880:Rxra	UTSW	2	27748656	missense	possibly damaging	0.64
R6913:Rxra	UTSW	2	27741174	missense	probably damaging	1.00
R7404:Rxra	UTSW	2	27741854	missense	probably damaging	0.99
R8324:Rxra	UTSW	2	27741183	missense	probably damaging	1.00
R9098:Rxra	UTSW	2	27748744	missense	possibly damaging	0.50
R9200:Rxra	UTSW	2	27737484	missense	possibly damaging	0.64
R9356:Rxra	UTSW	2	27759663	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATGCTCACTTCCTGTGGAC -3'
(R):5'- TAGAGTGCCACTTGAGCCTC -3'

Sequencing Primer
(F):5'- ACTTCCTGTGGACTTGGCCAG -3'
(R):5'- TCTCCATTACATCTCCAGACAAGTGG -3'

Posted On

2014-06-23